 
REBASE version 901                                              withrefm_neb.901
 
    =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
    REBASE, The Restriction Enzyme Database   http://rebase.neb.com
    Copyright (c)  Dr. Richard J. Roberts, 2018.   All rights reserved.
    =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=
 
Rich Roberts                                                    Dec 28 2018
 

<ENZYME NAME>   Restriction enzyme name.
<ISOSCHIZOMERS> Other enzymes with this specificity.
<RECOGNITION SEQUENCE> 
                These are written from 5' to 3', only one strand being given.
                If the point of cleavage has been determined, the precise site
                is marked with ^.  For enzymes such as HgaI, MboII etc., which
                cleave away from their recognition sequence the cleavage sites
                are indicated in parentheses.  

                For example HgaI GACGC (5/10) indicates cleavage as follows:
                                5' GACGCNNNNN^      3'
                                3' CTGCGNNNNNNNNNN^ 5'

                In all cases the recognition sequences are oriented so that
                the cleavage sites lie on their 3' side.

                REBASE Recognition sequences representations use the standard 
                abbreviations (Eur. J. Biochem. 150: 1-5, 1985) to represent 
                ambiguity.
                                R = G or A
                                Y = C or T
                                M = A or C
                                K = G or T
                                S = G or C
                                W = A or T
                                B = not A (C or G or T)
                                D = not C (A or G or T)
                                H = not G (A or C or T)
                                V = not T (A or C or G)
                                N = A or C or G or T



                ENZYMES WITH UNUSUAL CLEAVAGE PROPERTIES:  

                Enzymes that cut on both sides of their recognition sequences,
                such as BcgI, Bsp24I, CjeI and CjePI, have 4 cleavage sites
                each instead of 2.

                Bsp24I
                          5'      ^NNNNNNNNGACNNNNNNTGGNNNNNNNNNNNN^   3'
                          3' ^NNNNNNNNNNNNNCTGNNNNNNACCNNNNNNN^        5'


                This will be described in some REBASE reports as:

                             Bsp24I (8/13)GACNNNNNNTGG(12/7)

<METHYLATION SITE>
                The site of methylation by the cognate methylase when known
                is indicated X(Y) or X,X2(Y,Y2), where X is the base within
                the recognition sequence that is modified.  A negative number
                indicates the complementary strand, numbered from the 5' base 
                of that strand, and Y is the specific type of methylation 
                involved:
                               (6) = N6-methyladenosine 
                               (5) = 5-methylcytosine 
                               (4) = N4-methylcytosine

                If the methylation information is different for the 3' strand,
                X2 and Y2 are given as well.

<MICROORGANISM> Organism from which this enzyme had been isolated.
<SOURCE>        Either an individual or a National Culture Collection.
<COMMERCIAL AVAILABILITY>
                Each commercial source of restriction enzymes and/or methylases
                listed in REBASE is assigned a single character abbreviation 
                code.  For example:

                K        Takara (1/98)
                M        Boehringer Mannheim (10/97)
                N        New England Biolabs (4/98)
 
                The date in parentheses indicates the most recent update of 
                that organization's listings in REBASE.

<REFERENCES>only the primary references for the isolation and/or purification
of the restriction enzyme or methylase, the determination of the recognition
sequence and cleavage site or the methylation specificity are given.


REBASE codes for commercial sources of enzymes

                B        Life Technologies (12/18)
                C        Minotech Biotechnology (12/18)
                E        Agilent Technologies (11/16)
                I        SibEnzyme Ltd. (12/18)
                J        Nippon Gene Co., Ltd. (12/18)
                K        Takara Bio Inc. (6/18)
                M        Roche Applied Science (4/18)
                N        New England Biolabs (12/18)
                O        Toyobo Biochemicals (8/14)
                Q        Molecular Biology Resources - CHIMERx (12/18)
                R        Promega Corporation (1/18)
                S        Sigma Chemical Corporation (12/18)
                V        Vivantis Technologies (1/18)
                X        EURx Ltd. (11/18)
                Y        SinaClon BioScience Co. (1/18)

<1>AatII
<2>ZraI
<3>GACGT^C
<4>2(6)
<5>Acetobacter aceti IFO 3281
<6>IFO 3281
<7>BIKMNV
<8>Clark, T.A., Murray, I.A., Morgan, R.D., Kislyuk, A.O., Spittle, K.E., Boitano, M., Fomenkov, A., Roberts, R.J., Korlach, J., (2012) Nucleic Acids Res., vol. 40.
Fomenkov, A., Unpublished observations.
Sugisaki, H., Maekawa, Y., Kanazawa, S., Takanami, M., (1982) Nucleic Acids Res., vol. 10, pp. 5747-5752.
Xu, S.-Y., Nwankwo, D.O., European Patent Office, 1992.

<1>AbaSI
<2>PvuRts1I
<3>C(11/9)
<4>
<5>Acinetobacter baumannii SDF
<6>D. Vallenet
<7>N
<8>Borgaro, J.G., Zhu, Z., (2013) Nucleic Acids Res., vol. 41, pp. 4198-4206.

<1>AccI
<2>
<3>GT^MKAC
<4>5(6)
<5>Acinetobacter calcoaceticus
<6>ATCC 49823
<7>BJKMNQRX
<8>Fomenkov, A., Unpublished observations.
Kawakami, B., Hilzheber, C., Nagatomo, M., Oka, M., (1991) Agric. Biol. Chem., vol. 55, pp. 1553-1559.
Kawakami, B., Maekawa, Y., Japanese Patent Office, 1991.
Lunnen, K.D., Barsomian, J.M., Camp, R.R., Card, C.O., Chen, S.-Z., Croft, R., Looney, M.C., Meda, M.M., Moran, L.S., Nwankwo, D.O., Slatko, B.E., Van Cott, E.M., Wilson, G.G., (1988) Gene, vol. 74, pp. 25-32.
Zabeau, M., Roberts, R.J., Unpublished observations.

<1>Acc65I
<2>KpnI
<3>G^GTACC
<4>4(6)
<5>Acinetobacter calcoaceticus 65
<6>S.K. Degtyarev
<7>BINV
<8>Fomenkov, A., Unpublished observations.
Fomenkov, A., Vincze, T., Degtyarev, S.K., Roberts, R.J., (2017) Genome Announcements, vol. 5.
Lunnen, K., Greci, J., Wilson, G., US Patent Office, 2010.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Prichodko, G.G., Rechnukova, N.I., Repin, V.E., Degtyarev, S.K., (1991) Sib. Biol. J., vol. 1, pp. 59-60.

<1>AciI
<2>
<3>CCGC(-3/-1)
<4>1(5),-2(5)
<5>Arthrobacter citreus
<6>NEB 577
<7>N
<8>Heiter, D.F., Lunnen, K.D., Wilson, G.G., Unpublished observations.
Lunnen, K.D., Heiter, D., Wilson, G.G., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Polisson, C., Morgan, R.D., (1990) Nucleic Acids Res., vol. 18, pp. 5911.
Samuelson, J., Unpublished observations.

<1>AclI
<2>
<3>AA^CGTT
<4>3(5)
<5>Acinetobacter calcoaceticus M4
<6>S.K. Degtyarev
<7>INV
<8>Degtyarev, S.K., Abdurashitov, M.A., Kolyhalov, A.A., Rechkunova, N.I., (1992) Nucleic Acids Res., vol. 20, pp. 3787.
Fomenkov, A., Unpublished observations.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.

<1>AcuI
<2>Eco57I
<3>CTGAAG(16/14)
<4>?(6)
<5>Acinetobacter calcoaceticus SRW4
<6>S.K. Degtyarev
<7>IN
<8>Degtyarev, S.K., Kileva, E.V., Dedkov, V.S., Unpublished observations.
Fomenkov, A., Unpublished observations.
Samuelson, J., Xu, S.-Y., O'Loane, D., US Patent Office, 2006.

<1>AfeI
<2>Eco47III
<3>AGC^GCT
<4>
<5>Alcaligenes faecalis T2774
<6>NEB 1775
<7>IN
<8>Abdurashitov, M.A., Kileva, E.V., Shevchenko, A.V., Degtyarev, S.K., Unpublished observations.
Lunnen, K., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>AflII
<2>
<3>C^TTAAG
<4>5(6)
<5>Anabaena flos-aquae
<6>CCAP 1403/13f
<7>JKN
<8>Fomenkov, A., Unpublished observations.
Lunnen, K.D., Wilson, G.G., US Patent Office, 1991.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Whitehead, P.R., Brown, N.L., (1985) J. Gen. Microbiol., vol. 131, pp. 951-958.
Wilson, G.G., Lunnen, K.D., Unpublished observations.

<1>AflIII
<2>
<3>A^CRYGT
<4>2(4)
<5>Anabaena flos-aquae
<6>CCAP 1403/13f
<7>MNS
<8>Fomenkov, A., Unpublished observations.
Lunnen, K.D., Moran, L., Slatko, B.E., Wilson, G.G., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Stickel, S.K., Roberts, R.J., Unpublished observations.
Whitehead, P.R., Brown, N.L., (1985) J. Gen. Microbiol., vol. 131, pp. 951-958.

<1>AgeI
<2>
<3>A^CCGGT
<4>?(5)
<5>Agrobacterium gelatinovorum
<6>IAM 12617
<7>JNR
<8>Fomenkov, A., Unpublished observations.
Suzuki, T., Sugimoto, E., Tahara, Y., Yamada, Y., (1996) Biosci. Biotechnol. Biochem., vol. 60, pp. 444-447.
Xu, S.-Y., Maunus, R.E., Lunnen, K.D., Allen, R., US Patent Office, 1999.
Yamada, Y., Mizuno, H., Sato, H., Akagawa, M., Yamasato, K., (1989) Agric. Biol. Chem., vol. 53, pp. 1747-1749.

<1>AhdI
<2>Eam1105I
<3>GACNNN^NNGTC
<4>2(6)
<5>Aeromonas hydrophila
<6>NEB 724
<7>N
<8>Chang, Z., Morgan, R., Unpublished observations.
Fomenkov, A., Unpublished observations.
Fomenkov, A., Roberts, R.J., Unpublished observations.
Lunnen, K.L., Tao, C., Wilson, G.G., Unpublished observations.
Polisson, C., Unpublished observations.

<1>AleI
<2>OliI
<3>CACNN^NNGTG
<4>2(6)
<5>Aureobacterium liquefaciens
<6>NEB 1374
<7>N
<8>Degtyarev, S.K., Unpublished observations.
Fomenkov, A., Unpublished observations.
Wilson, G.G., Lunnen, K.D., Unpublished observations.

<1>AluI
<2>
<3>AG^CT
<4>3(5)
<5>Arthrobacter luteus
<6>ATCC 21606
<7>BCIJKMNOQRSVXY
<8>Fomenkov, A., Unpublished observations.
Kramarov, V.M., Smolyaninov, V.V., (1981) Biokhimiia, vol. 46, pp. 1526-1529.
Labeots, L.A., (1993) Diss. Abstr., vol. 53, pp. 2842.
Roberts, R.J., Myers, P.A., Morrison, A., Murray, K., (1976) J. Mol. Biol., vol. 102, pp. 157-165.
Smith, M.D., Schmidt, B.J., Longo, M.C., Chatterjee, D.K., US Patent Office, 1994.
Ware, J., Zhang, B.-H., Slatko, B.S., Wilson, G.G., Unpublished observations.
Ware, J., Zhang, B.-H., Slatko, B.S., Wilson, G.G., Unpublished observations.
Yoon, H., Suh, H., Kim, K., Han, M.H., Yoo, O.J., (1985) Korean Biochem. J., vol. 18, pp. 88-93.

<1>AlwI
<2>BinI
<3>GGATC(4/5)
<4>3(6),-2(6)
<5>Acinetobacter lwoffi
<6>NEB 402
<7>N
<8>Fomenkov, A., Unpublished observations.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Morgan, R., Bonventre, J., Unpublished observations.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>AlwNI
<2>
<3>CAGNNN^CTG
<4>
<5>Acinetobacter lwoffi
<6>NEB 419
<7>N
<8>Morgan, R.D., Unpublished observations.
Morgan, R.D., Dalton, M., Stote, R., (1987) Nucleic Acids Res., vol. 15, pp. 7201.
Zhu, Z., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>ApaI
<2>PspOMI
<3>GGGCC^C
<4>4(5)
<5>Acetobacter pasteurianus sub. pasteurianus
<6>NCIB 7215
<7>BIJKMNQRSVX
<8>Gunthert, U., Trautner, T.A., (1984) Curr. Top. Microbiol. Immunol., vol. 108, pp. 11-22.
Kong, H., Unpublished observations.
Kong, H., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Seurinck, J., Van de Voorde, A., Van Montagu, M., (1983) Nucleic Acids Res., vol. 11, pp. 4409-4415.
Trautner, T.A., Unpublished observations.
Yamada, Y., Murakami, M., (1985) Agric. Biol. Chem., vol. 49, pp. 3627-3629.

<1>ApaLI
<2>
<3>G^TGCAC
<4>4(5)
<5>Acetobacter pasteurianus
<6>IFO 13753
<7>CKN
<8>Fomenkov, A., Unpublished observations.
Murakami, M., Yamada, Y., (1990) Agric. Biol. Chem., vol. 54, pp. 1791-1796.
Suzuki, T., Sugimoto, E., Tahara, Y., Yamada, Y., (1996) Biosci. Biotechnol. Biochem., vol. 60, pp. 1401-1405.
Xia, Y., Van Etten, J.L., Dobos, P., Ling, Y.Y., Krell, P.J., (1993) Virology, vol. 196, pp. 817-824.
Xu, S.-Y., Xiao, J.-P., Ettwiller, L., Holden, M., Aliotta, J., Poh, C.L., Dalton, M., Robinson, D.P., Petronzio, T.R., Moran, L., Ganatra, M., Ware, J., Slatko, B., Benner, J., (1998) Mol. Gen. Genet., vol. 260, pp. 226-231.
Yamada, Y., Murakami, M., (1985) Agric. Biol. Chem., vol. 49, pp. 3627-3629.

<1>ApeKI
<2>TseI
<3>G^CWGC
<4>?(5)
<5>Aeropyrum pernix K1
<6>ATCC 700893
<7>N
<8>Kawarabayasi, Y. et al., (1999) DNA Res., vol. 6, pp. 83-101.
Opitz, L., Xu, S.-Y., Unpublished observations.
Xu, S.-Y., Opitz, L., Unpublished observations.

<1>ApoI
<2>
<3>R^AATTY
<4>3(6)
<5>Arthrobacter protophormiae
<6>NEB 723
<7>N
<8>Fomenkov, A., Unpublished observations.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Polisson, C., Robinson, D., (1992) Nucleic Acids Res., vol. 20, pp. 2888.

<1>AscI
<2>
<3>GG^CGCGCC
<4>?(5)
<5>Arthrobacter species
<6>NEB 688
<7>N
<8>Lunnen, K.D., Wilson, G.G., Unpublished observations.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Morgan, R., European Patent Office, 1992.
Morgan, R.D., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.

<1>AseI
<2>VspI
<3>AT^TAAT
<4>?(6)
<5>Aquaspirillum serpens
<6>NEB 448
<7>JN
<8>Morgan, R.D., US Patent Office, 1992.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Polisson, C., Morgan, R.D., (1988) Nucleic Acids Res., vol. 16, pp. 10365.
Stewart, F., Morgan, R.D., Unpublished observations.
Stewart, F., Morgan, R.D., Unpublished observations.

<1>AsiSI
<2>SgfI
<3>GCGAT^CGC
<4>2(5)
<5>Arthrobacter species S
<6>S.K. Degtyarev
<7>IN
<8>Abdurashitov, M.A., Shinkarenko, N.M., Shevchenko, A.V., Dedkov, V.S., Degtyarev, S.K., Unpublished observations.
Morgan, R.D., Unpublished observations.
Zhu, Z., Xu, S.-Y., Unpublished observations.
Zhu, Z., Xu, S.-Y., US Patent Office, 2003.

<1>AvaI
<2>BsoBI
<3>C^YCGRG
<4>?(4)
<5>Anabaena variabilis ATCC 27893
<6>ATCC 27893
<7>JNQX
<8>Hughes, S.G., Murray, K., (1980) Biochem. J., vol. 185, pp. 65-75.
Kaneko, T. et al., (2001) DNA Res., vol. 8, pp. 205-213.
Lunnen, K.D., Barsomian, J.M., Camp, R.R., Card, C.O., Chen, S.-Z., Croft, R., Looney, M.C., Meda, M.M., Moran, L.S., Nwankwo, D.O., Slatko, B.E., Van Cott, E.M., Wilson, G.G., (1988) Gene, vol. 74, pp. 25-32.
Murray, K., Hughes, S.G., Brown, J.S., Bruce, S.A., (1976) Biochem. J., vol. 159, pp. 317-322.
Ruan, H., Lunnen, K.D., Scott, M.E., Moran, L.S., Slatko, B.E., Pelletier, J.J., Hess, E.J., Benner, J., Wilson, G.G., Xu, S.-Y., (1996) Mol. Gen. Genet., vol. 252, pp. 695-699.
Xu, S.-Y., Unpublished observations.

<1>AvaII
<2>
<3>G^GWCC
<4>?(5)
<5>Anabaena variabilis ATCC 27893
<6>ATCC 27893
<7>JNRX
<8>Fuchs, C., Rosenvold, E.C., Honigman, A., Szybalski, W., (1978) Gene, vol. 4, pp. 1-23.
Hughes, S.G., Murray, K., (1980) Biochem. J., vol. 185, pp. 65-75.
Kaneko, T. et al., (2001) DNA Res., vol. 8, pp. 205-213.
Lunnen, K.D., Barsomian, J.M., Camp, R.R., Card, C.O., Chen, S.-Z., Croft, R., Looney, M.C., Meda, M.M., Moran, L.S., Nwankwo, D.O., Slatko, B.E., Van Cott, E.M., Wilson, G.G., (1988) Gene, vol. 74, pp. 25-32.
Lunnen, K.D., Wilson, G.G., Kroeger, M., Unpublished observations.
Murray, K., Hughes, S.G., Brown, J.S., Bruce, S.A., (1976) Biochem. J., vol. 159, pp. 317-322.
Sutcliffe, J.G., Church, G.M., (1978) Nucleic Acids Res., vol. 5, pp. 2313-2319.

<1>AvrII
<2>
<3>C^CTAGG
<4>
<5>Anabaena variabilis uw
<6>E.C. Rosenvold
<7>N
<8>Lunnen, K.D., Moran, L.S., Slatko, B.E., Wilson, G.G., Unpublished observations.
Lunnen, K.D., Moran, L.S., Slatko, B.E., Wilson, G.G., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Rosenvold, E.C., Szybalski, W., Unpublished observations.

<1>BaeI
<2>
<3>(10/15)ACNNNNGTAYC(12/7)
<4>
<5>Bacillus sphaericus
<6>NEB 659
<7>N
<8>Fomenkov, A., Unpublished observations.
Sears, L.E., Zhou, B., Aliotta, J.M., Morgan, R.D., Kong, H., (1996) Nucleic Acids Res., vol. 24, pp. 3590-3592.
Zhu, Z., Roberts, R.J., Unpublished observations.
Zhu, Z., Xu, S.-Y., Unpublished observations.

<1>BaeGI
<2>BseSI
<3>GKGCM^C
<4>6(5)
<5>Bacillus aestuarii GG790
<6>NEB 1902
<7>N
<8>Fomenkov, A., Unpublished observations.
Pan, X.S., Morgan, R., Unpublished observations.
Zhu, Z., Xu, S.-Y., Unpublished observations.

<1>BamHI
<2>
<3>G^GATCC
<4>5(4)
<5>Bacillus amyloliquefaciens H
<6>ATCC 49763
<7>BCIJKMNOQRSVXY
<8>Brooks, J.E., Nathan, P.D., Landry, D., Sznyter, L.A., Waite-Rees, P., Ives, C.L., Moran, L.S., Slatko, B.E., Benner, J.S., (1991) Nucleic Acids Res., vol. 19, pp. 841-850.
Endo, M., Majima, T., Japanese Patent Office, 2003.
Fomenkov, A., Unpublished observations.
Hattman, S., Keister, T., Gottehrer, A., (1978) J. Mol. Biol., vol. 124, pp. 701-711.
Majima, T., Endo, M., Japanese Patent Office, 2006.
Roberts, R.J., Wilson, G.A., Young, F.E., (1977) Nature, vol. 265, pp. 82-84.
Usami, S., Kurimura, H., Kino, K., Kamigaki, K., Kirimura, K., Japanese Patent Office, 2003.
Wilson, G.A., Young, F.E., (1975) J. Mol. Biol., vol. 97, pp. 123-125.

<1>BanI
<2>HgiCI
<3>G^GYRCC
<4>?(5)
<5>Bacillus aneurinolyticus
<6>IAM 1077
<7>NR
<8>Fomenkov, A., Unpublished observations.
Kawakami, B., Maekawa, Y., Japanese Patent Office, 1989.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Maekawa, Y., Kawakami, F., Yasukawa, H., Japanese Patent Office, 1991.
Maekawa, Y., Yasukawa, H., Kawakami, B., (1990) J. Biochem. (Tokyo), vol. 107, pp. 645-649.
Schildkraut, I., Lynch, J., Morgan, R., (1987) Nucleic Acids Res., vol. 15, pp. 5492.
Sugisaki, H., Maekawa, Y., Kanazawa, S., Takanami, M., (1982) Nucleic Acids Res., vol. 10, pp. 5747-5752.

<1>BanII
<2>HgiJII
<3>GRGCY^C
<4>4(5)
<5>Bacillus aneurinolyticus
<6>IAM 1077
<7>KNX
<8>Fomenkov, A., Unpublished observations.
Forrow, S., Lee, M., Souhami, R.L., Hartley, J.A., (1994) ACS Abstracts, vol. 208, pp. 97.
Kilz, S., Kroeger, M., Lunnen, K.D., Wilson, G.G., Unpublished observations.
Lunnen, K.D., Barsomian, J.M., Camp, R.R., Card, C.O., Chen, S.-Z., Croft, R., Looney, M.C., Meda, M.M., Moran, L.S., Nwankwo, D.O., Slatko, B.E., Van Cott, E.M., Wilson, G.G., (1988) Gene, vol. 74, pp. 25-32.
Lunnen, K.D., Kilz, S., Kroeger, M., Wilson, G.G., Unpublished observations.
Sugisaki, H., Maekawa, Y., Kanazawa, S., Takanami, M., (1982) Nucleic Acids Res., vol. 10, pp. 5747-5752.
Wilson, G.G., Unpublished observations.

<1>BbsI
<2>BbvII
<3>GAAGAC(2/6)
<4>
<5>Bacillus brevis
<6>NEB 573
<7>N
<8>Story, C.M., Morgan, R., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>BbvI
<2>
<3>GCAGC(8/12)
<4>2(5),-2(5)
<5>Bacillus brevis
<6>ATCC 9999
<7>N
<8>Barsomian, J.M., Wilson, G.G., Unpublished observations.
Gingeras, T.R., Milazzo, J.P., Roberts, R.J., (1978) Nucleic Acids Res., vol. 5, pp. 4105-4127.
Hattman, S., Keister, T., Gottehrer, A., (1978) J. Mol. Biol., vol. 124, pp. 701-711.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Schildkraut, I., Unpublished observations.

<1>BbvCI
<2>
<3>CCTCAGC(-5/-2)
<4>?(5)
<5>Bacillus brevis
<6>NEB 1030
<7>N
<8>Ge, L., Unpublished observations.
Heiter, D., Lunnen, K., Wilson, G.G., US Patent Office, 2006.
Heiter, D.F., Lunnen, K.D., Wilson, G.G., (2005) J. Mol. Biol., vol. 348, pp. 631-640.
Krotee, S., Ganatra, M., Grandoni, R., Unpublished observations.
Lunnen, K.D., Heiter, D., Wilson, G.G., Unpublished observations.
Morgan, R.D., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.

<1>BccI
<2>
<3>CCATC(4/5)
<4>3(6)
<5>Bacteroides caccae
<6>NEB 669
<7>N
<8>Fomenkov, A., Unpublished observations.
Morgan, R., Reinecke, S., Unpublished observations.
Morgan, R.D., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.

<1>BceAI
<2>BcefI
<3>ACGGC(12/14)
<4>?(4)
<5>Bacillus cereus 1315
<6>NEB 1288
<7>N
<8>Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Nkenfou, C., Unpublished observations.
Nkenfou, C., (2002) Ph.D. Thesis, University of Yaounde I, Cameroon (Yaounde), pp. 1-226.
Nkenfou, C., Polisson, C., Nkenfou, J., Notedji, A., Morgan, R., Unpublished observations.

<1>BcgI
<2>
<3>(10/12)CGANNNNNNTGC(12/10)
<4>3(6),-3(6)
<5>Bacillus coagulans
<6>NEB 566
<7>N
<8>Kong, H., Unpublished observations.
Kong, H., Morgan, R.D., Maunus, R.E., Schildkraut, I., (1993) Nucleic Acids Res., vol. 21, pp. 987-991.
Kong, H., Roemer, S.E., Waite-Rees, P.A., Benner, J.S., Wilson, G.G., Nwankwo, D.O., (1994) J. Biol. Chem., vol. 269, pp. 683-690.
Kong, H., Schildkraut, I., European Patent Office, 1994.

<1>BciVI
<2>
<3>GTATCC(6/5)
<4>
<5>Bacillus circulans
<6>NEB 1000
<7>N
<8>Fomenkov, A., Unpublished observations.
Le, T.K.T., Vu, T.K.L., Vu, H.N., Polisson, C., Morgan, R., Unpublished observations.
Wei, H., Unpublished observations.

<1>BclI
<2>
<3>T^GATCA
<4>3(6)
<5>Bacillus caldolyticus
<6>A. Atkinson
<7>BCJMNORS
<8>Bingham, A.H.A., Atkinson, T., Sciaky, D., Roberts, R.J., (1978) Nucleic Acids Res., vol. 5, pp. 3457-3467.
Fomenkov, A., Unpublished observations.
Fomenkov, A., Vincze, T., Mersha, F., Roberts, R.J., (2018) Genome Announcements, vol. 6.
Mersha, F., Unpublished observations.
Mersha, F., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Strimpel, D., Stickel, S., Roberts, R.J., Unpublished observations.

<1>BcoDI
<2>BsmAI
<3>GTCTC(1/5)
<4>?(5)
<5>Bacteroides coprocola DSM 17136
<6>DSM 17136
<7>N
<8>Chan, S.H., Xu, S.-Y., Unpublished observations.
Fulton, L., Clifton, S., Fulton, B., Xu, J., Minx, P., Mardis, E.R., Wilson, R.K., Unpublished observations.
Fulton, L., Clifton, S., Fulton, B., Xu, J., Minx, P., Pepin, K.H., Johnson, M., Thiruvilangam, P., Bhonagiri, V., Nash, W.E., Mardis, E.R., Wilson, R.K., Unpublished observations.

<1>BfaI
<2>MaeI
<3>C^TAG
<4>
<5>Bacteroides fragilis
<6>NEB 1140
<7>N
<8>Lunnen, K.D., Wilson, G.G., Unpublished observations.
McLeod, B., Unpublished observations.
McLeod, E., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Reinecke, S.N., Morgan, R.D., (1991) Nucleic Acids Res., vol. 19, pp. 1152.

<1>BfuAI
<2>BspMI
<3>ACCTGC(4/8)
<4>2(5)
<5>Bacillus fusiformis 1083
<6>NEB 1292
<7>N
<8>Fomenkov, A., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Nkenfou, C., Polisson, C., Unpublished observations.
Nkenfou, C., Polisson, C., Nkenfou, J., Notedji, A., Morgan, R., Unpublished observations.

<1>BglI
<2>
<3>GCCNNNN^NGGC
<4>2(4)
<5>Bacillus globigii
<6>ATCC 49760
<7>BCIJKNOQRVX
<8>Bickle, T.A., Ineichen, K., (1980) Gene, vol. 9, pp. 205-212.
Dedkov, V.S., Gonchar, D.A., Abdurashitov, M.A., Udalyeva, S.G., Urumceva, L.A., Chernukhin, V.A., Mutylo, G.V., Degtyarev, S.K., (2015) Res. J. Pharm. Biol. Chem. Sci., vol. 6, pp. 1341-1348.
Duncan, C.H., Wilson, G.A., Young, F.E., (1978) J. Bacteriol., vol. 134, pp. 338-344.
Lautenberger, J.A., White, C.T., Haigwood, N.L., Edgell, M.H., Hutchison, C.A., (1980) Gene, vol. 9, pp. 213-231.
Lunnen, K.D., Barsomian, J.M., Camp, R.R., Card, C.O., Chen, S.-Z., Croft, R., Looney, M.C., Meda, M.M., Moran, L.S., Nwankwo, D.O., Slatko, B.E., Van Cott, E.M., Wilson, G.G., (1988) Gene, vol. 74, pp. 25-32.
Lunnen, K.D., Wilson, G.G., US Patent Office, 1994.
Morgan, R.D., (2016) Genome Announcements, vol. 4.
Van Heuverswyn, H., Fiers, W., (1980) Gene, vol. 9, pp. 195-203.

<1>BglII
<2>
<3>A^GATCT
<4>5(4)
<5>Bacillus globigii
<6>ATCC 49760
<7>BCIJKMNOQRSVX
<8>Anton, B.P., Brooks, J.E., Unpublished observations.
Anton, B.P., Heiter, D.F., Benner, J.S., Hess, E.J., Greenough, L., Moran, L.S., Slatko, B.E., Brooks, J.E., (1997) Gene, vol. 187, pp. 19-27.
Duncan, C.H., Wilson, G.A., Young, F.E., (1978) J. Bacteriol., vol. 134, pp. 338-344.
Morgan, R.D., (2016) Genome Announcements, vol. 4.
Pirrotta, V., (1976) Nucleic Acids Res., vol. 3, pp. 1747-1760.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>BlpI
<2>EspI
<3>GC^TNAGC
<4>?(5)
<5>Bacillus species lp
<6>NEB 819
<7>N
<8>Chang, Z., Morgan, R., Unpublished observations.
Heiter, D., Lunnen, K., Wilson, G.G., US Patent Office, 2006.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Polisson, C., Unpublished observations.

<1>BmgBI
<2>BtrI
<3>CACGTC(-3/-3)
<4>
<5>Bacillus thermoglucosidasius BmgB
<6>NEB 1353
<7>N
<8>Fomenkov, A., Unpublished observations.
Le, T.K.T., Vu, H.N., Vu, T.K.L., Polisson, C., Morgan, R., Unpublished observations.
Nkenfou, C., Morgan, R.D., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>BmrI
<2>BfiI
<3>ACTGGG(5/4)
<4>?(4)
<5>Bacillus megaterium GC subgroup A
<6>NEB 1067
<7>N
<8>Bao, Y., Higgins, L., Zhang, P., Chan, S.H., Laget, S., Sweeney, S., Lunnen, K., Xu, S.Y., (2008) Protein Expr. Purif., vol. 58, pp. 42-52.
Krotee, S., Ganatra, M., Unpublished observations.
Le, T.K.T., Morgan, R., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Sears, L., Wilson, G.G., Kong, H., Unpublished observations.

<1>BmtI
<2>NheI
<3>GCTAG^C
<4>
<5>Bacillus megaterium S2
<6>NEB 1776
<7>INV
<8>Dedkov, V.S., Gonchar, D.A., Abdurashitov, M.A., Udalyeva, S.G., Urumceva, L.A., Chernukhin, V.A., Mutylo, G.V., Degtyarev, S.K., (2015) Res. J. Pharm. Biol. Chem. Sci., vol. 6, pp. 1341-1348.
Dedkov, V.S., Nayakshina, T.N., Popichenko, D.V., Degtyarev, S.K., (2003) Biotekhnologiya, vol. 1, pp. 11-15.
Fomenkov, A., Unpublished observations.
Zhu, Z., Unpublished observations.

<1>BpmI
<2>GsuI
<3>CTGGAG(16/14)
<4>?(6)
<5>Bacillus pumilus
<6>NEB 711
<7>IN
<8>Degtyarev, S.K., Morgan, R., Unpublished observations.
Zhou, J., Zhu, Z., Xu, S.Y., US Patent Office, 2002.

<1>Bpu10I
<2>
<3>CCTNAGC(-5/-2)
<4>?(5)
<5>Bacillus pumilus 10
<6>NEB 1777
<7>BINV
<8>Dedkov, V.S., Gonchar, D.A., Abdurashitov, M.A., Udalyeva, S.G., Urumceva, L.A., Chernukhin, V.A., Mutylo, G.V., Degtyarev, S.K., (2015) Res. J. Pharm. Biol. Chem. Sci., vol. 6, pp. 1341-1348.
Degtyarev, S.K., Zilkin, P.A., Prihodko, G.G., Repin, V.E., Rechkunova, N.I., (1989) Mol. Biol. (Mosk), vol. 23, pp. 1051-1056.
Stankevicius, K., Lubys, A., Timinskas, A., Vaitkevicius, D., Janulaitis, A., (1998) Nucleic Acids Res., vol. 26, pp. 1084-1091.

<1>BpuEI
<2>Bce83I
<3>CTTGAG(16/14)
<4>5(6)
<5>Bacillus pumilus 2187a
<6>NEB 1378
<7>N
<8>Fomenkov, A., Unpublished observations.
Murray, I.A., Wei, H., Unpublished observations.
Nkenfou, C., Polisson, C., Nkenfou, J., Notedji, A., Morgan, R., Unpublished observations.

<1>BsaI
<2>Eco31I
<3>GGTCTC(1/5)
<4>-4(6)
<5>Bacillus stearothermophilus 6-55
<6>Z. Chen
<7>N
<8>Fomenkov, A., Unpublished observations.
Kong, H., Chen, Z., Unpublished observations.
Morgan, R.D., Unpublished observations.
Xu, S.-Y., Unpublished observations.
Zhu, Z., Xu, S.-Y., Unpublished observations.
Zhu, Z., Xu, S.-Y., US Patent Office, 2003.

<1>BsaAI
<2>
<3>YAC^GTR
<4>3(5)
<5>Bacillus stearothermophilus G668
<6>Z. Chen
<7>N
<8>Kong, H., Unpublished observations.
Kong, H., Morgan, R.D., Chen, Z., (1990) Nucleic Acids Res., vol. 18, pp. 2832.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Zhu, Z., Unpublished observations.

<1>BsaBI
<2>
<3>GATNN^NNATC
<4>
<5>Bacillus stearothermophilus B674
<6>NEB 537
<7>N
<8>Chen, Z., Kong, H., Unpublished observations.
Fomenkov, A., Unpublished observations.
Fomenkov, A., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.
Zhu, Z., Xu, S.-Y., Unpublished observations.

<1>BsaHI
<2>AcyI
<3>GR^CGYC
<4>?(5)
<5>Bacillus stearothermophilus CPW11
<6>Z. Chen
<7>N
<8>Chen, W., Pan, X., Chen, Z., Unpublished observations.
Morgan, R.D., Unpublished observations.
Neely, R.K., Roberts, R.J., (2008) BMC Mol. Biol., vol. 9, pp. 48.

<1>BsaJI
<2>SecI
<3>C^CNNGG
<4>?(4)
<5>Bacillus stearothermophilus J695
<6>Z. Chen
<7>N
<8>Kong, H., Chen, Z., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Xu, S.-Y., Unpublished observations.

<1>BsaWI
<2>BetI
<3>W^CCGGW
<4>1(5)
<5>Bacillus stearothermophilus W1718
<6>Z. Chen
<7>N
<8>Chen, W., Pan, X., Chen, Z., Unpublished observations.
Fomenkov, A., Unpublished observations.
Morgan, R.D., Unpublished observations.
Wu, V., Anton, B.P., Unpublished observations.
Wu, V., Anton, B.P., Fomenkov, A., Roberts, R.J., Unpublished observations.
Xu, S.-Y., Unpublished observations.
Xu, S.-Y., Zhou, J., Hume, A., Maunus, R., US Patent Office, 2003.

<1>BsaXI
<2>
<3>(9/12)ACNNNNNCTCC(10/7)
<4>
<5>Bacillus stearothermophilus Cpw230
<6>Z. Chen
<7>N
<8>Chen, Z., Unpublished observations.
Morgan, R.D., Unpublished observations.
Polisson, C., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.
Zhu, Z., Xu, S.-Y., Unpublished observations.

<1>BseRI
<2>
<3>GAGGAG(10/8)
<4>5(6),-4(4)
<5>Bacillus species R
<6>CAMB 2669
<7>N
<8>Fomenkov, A., Unpublished observations.
Fomenkov, A., Unpublished observations.
Morgan, R.D., Unpublished observations.
Mushtaq, R., Naeem, S., Sohail, A., Riazuddin, S., (1993) Nucleic Acids Res., vol. 21, pp. 3585.

<1>BseYI
<2>
<3>CCCAGC(-5/-1)
<4>
<5>Bacillus species 2521
<6>NEB 1396
<7>N
<8>Bhatia, T., Morgan, R.D., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Nkenfou, C., Unpublished observations.
Nkenfou, C., Morgan, R.D., Unpublished observations.

<1>BsgI
<2>
<3>GTGCAG(16/14)
<4>?(6)
<5>Bacillus sphaericus GC subgroup
<6>NEB 581
<7>N
<8>Higgins, L.S., Kong, H., Unpublished observations.
Kong, H., Sears, L., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.

<1>BsiEI
<2>McrI
<3>CGRY^CG
<4>
<5>Bacillus species BsiE
<6>D. Clark
<7>N
<8>Fomenkov, A., Unpublished observations.
Mok, Y.K., Clark, D.R., Kam, K.M., Shaw, P.C., (1990) Nucleic Acids Res., vol. 18, pp. 4954.
Wu, V., Anton, B.P., Unpublished observations.
Zhu, Z., Unpublished observations.

<1>BsiHKAI
<2>HgiAI
<3>GWGCW^C
<4>
<5>Bacillus stearothermophilus
<6>P.C. Shaw
<7>N
<8>Fomenkov, A., Unpublished observations.
Lee, K.-F., Shi, S.-D., Kam, K.-M., Shaw, P.-C., (1992) Nucleic Acids Res., vol. 20, pp. 921.
Zhu, Z., Unpublished observations.

<1>BsiWI
<2>SplI
<3>C^GTACG
<4>5(4)
<5>Bacillus species BsiW
<6>D. Clark
<7>N
<8>Clark, D.R., Klein, S., Roberts, R.J., Unpublished observations.
Fomenkov, A., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Nwankwo, D., Unpublished observations.
Zhu, Z., Unpublished observations.
Zhu, Z., Xu, S.-Y., Unpublished observations.

<1>BslI
<2>BsiYI
<3>CCNNNNN^NNGG
<4>?(4)
<5>Bacillus species
<6>NEB 606
<7>N
<8>Cowan, D., Ward, J., Pelletier, J.J., Morgan, R., Unpublished observations.
Hsieh, P.-C., Xiao, J.-P., O'Loane, D., Xu, S.-Y., (2000) J. Bacteriol., vol. 182, pp. 949-955.

<1>BsmI
<2>
<3>GAATGC(1/-1)
<4>
<5>Bacillus stearothermophilus NUB36
<6>N. Welker
<7>JMNS
<8>Christ, C., Ingalls, D., Unpublished observations.
Myers, P.A., Roberts, R.J., Unpublished observations.
Zhou, J., Zhu, Z., Xu, S.Y., US Patent Office, 2002.

<1>BsmAI
<2>BcoDI
<3>GTCTC(1/5)
<4>?(5)
<5>Bacillus stearothermophilus A664
<6>Z. Chen
<7>N
<8>Kong, H., Morgan, R.D., Chen, Z., (1990) Nucleic Acids Res., vol. 18, pp. 686.
Zhou, J., Xu, S., Unpublished observations.

<1>BsmBI
<2>Esp3I
<3>CGTCTC(1/5)
<4>?(5),-4(6)
<5>Bacillus stearothermophilus B61
<6>NEB 857
<7>N
<8>Chen, Z., Morgan, R., Unpublished observations.
Fomenkov, A., Unpublished observations.
Xu, S.-Y., Unpublished observations.
Xu, S.-Y., Dore, A., Hume, A., Pelletier, J., Zhou, J., European Patent Office, 2003.
Xu, S.-Y., Dore, A., Hume, A., Pelletier, J., Zhou, J., US Patent Office, 2004.

<1>BsmFI
<2>FinI
<3>GGGAC(10/14)
<4>?(6)
<5>Bacillus stearothermophilus F
<6>Z. Chen
<7>N
<8>Chen, Z., Morgan, R., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Zhu, Z., Unpublished observations.
Zhu, Z., Xu, S.-Y., Unpublished observations.

<1>BsoBI
<2>AvaI
<3>C^YCGRG
<4>1(4)
<5>Bacillus stearothermophilus JN2091
<6>D. Clark
<7>N
<8>Clark, D., Unpublished observations.
Fomenkov, A., Unpublished observations.
Fomenkov, A., Dila, D.K., Raleigh, E.A., Xu, S.-Y., European Patent Office, 2004.
Ruan, H., Lunnen, K.D., Scott, M.E., Moran, L.S., Slatko, B.E., Pelletier, J.J., Hess, E.J., Benner, J., Wilson, G.G., Xu, S.-Y., (1996) Mol. Gen. Genet., vol. 252, pp. 695-699.
Spargo, C.A., Unpublished observations.

<1>Bsp1286I
<2>SduI
<3>GDGCH^C
<4>?(5)
<5>Bacillus sphaericus
<6>IAM 1286
<7>JKN
<8>Fomenkov, A., Unpublished observations.
Myers, P.A., Roberts, R.J., Unpublished observations.
Schildkraut, I., Christ, C., Unpublished observations.
Shibata, T., Ikawa, S., Kim, C., Ando, T., (1976) J. Bacteriol., vol. 128, pp. 473-476.
Zhu, Z., Unpublished observations.

<1>BspCNI
<2>BseMII
<3>CTCAG(9/7)
<4>?(6)
<5>Bacillus species 1310
<6>NEB 1303
<7>N
<8>Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Nkenfou, C., Unpublished observations.
Nkenfou, C., (2002) Ph.D. Thesis, University of Yaounde I, Cameroon (Yaounde), pp. 1-226.
Nkenfou, C., Polisson, C., Nkenfou, J., Notedji, A., Morgan, R., Unpublished observations.
Rausch, C., Morgan, R.D., Unpublished observations.

<1>BspDI
<2>ClaI
<3>AT^CGAT
<4>
<5>Bacillus species
<6>NEB 595
<7>N
<8>Kong, H., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>BspEI
<2>BspMII
<3>T^CCGGA
<4>
<5>Bacillus species
<6>NEB 553
<7>N
<8>Kong, H., Hoffman, L., Unpublished observations.
Lunnen, K., Nwankwo, D., Wilson, G., Unpublished observations.
Lunnen, K.D., Nwankwo, D.O., Wilson, G.G., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Nwankwo, D.O., (1995) Gene, vol. 157, pp. 31-35.

<1>BspHI
<2>
<3>T^CATGA
<4>3(6)
<5>Bacillus species H
<6>NEB 394
<7>N
<8>Anton, B.P., Clark, T., Boitano, M., Korlach, J., Roberts, R.J., Unpublished observations.
Hall, D., Camp, R., Morgan, R., Hoffman, L., Unpublished observations.
Luyten, Y.A., Morgan, R.D., Unpublished observations.
Morgan, R.D., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>BspMI
<2>BfuAI
<3>ACCTGC(4/8)
<4>?(5)
<5>Bacillus species M
<6>NEB 356
<7>N
<8>Morgan, R., Hoffman, L., Unpublished observations.
Morgan, R.D., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.

<1>BspQI
<2>SapI
<3>GCTCTTC(1/4)
<4>
<5>Bacillus sphaericus
<6>NEB 1214
<7>N
<8>Fomenkov, A., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Pan, X.S., Polisson, C., Morgan, R., Unpublished observations.
Xu, S.-Y., Unpublished observations.
Zhang, P.H., Too, P.H.M., Samuelson, J.C., Chan, S.H., Vincze, T., Doucette, S., Backstrom, S., Potamousis, K.D., Schramm, T.M., Forrest, D., Schwartz, D.C., Xu, S.Y., (2010) Protein Expr. Purif., vol. 69, pp. 226-234.
Zhu, Z., Blanchard, A., Xu, S.-Y., Guan, S., Wei, H., Zhang, P., Sun, D., Chan, S.-h., International Patent Office, 2009.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>BsrI
<2>
<3>ACTGG(1/-1)
<4>2(4),-1(4)
<5>Bacillus stearothermophilus NEB 447
<6>NEB 447
<7>N
<8>Fomenkov, A., Unpublished observations.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Polisson, C., Morgan, R.D., (1988) Nucleic Acids Res., vol. 16, pp. 5205.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>BsrBI
<2>
<3>CCGCTC(-3/-3)
<4>4(4),-4(4)
<5>Bacillus stearothermophilus CPW193
<6>Z. Chen
<7>N
<8>Chen, Z., Unpublished observations.
Fomenkov, A., Unpublished observations.
Heiter, D., Nwankwo, D.O., Wilson, G.G., Unpublished observations.
Heiter, D.F., Nwankwo, D.O., Wilson, G.G., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>BsrDI
<2>
<3>GCAATG(2/0)
<4>
<5>Bacillus stearothermophilus D70
<6>Z. Chen
<7>N
<8>Chen, Z., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Xu, S.Y., Zhu, Z., Zhang, P., Chan, S.H., Samuelson, J.C., Xiao, J., Ingalls, D., Wilson, G.G., (2007) Nucleic Acids Res., vol. 35, pp. 4608-4618.

<1>BsrFI
<2>Cfr10I
<3>R^CCGGY
<4>2(5)
<5>Bacillus stearothermophilus CPW16
<6>Z. Chen
<7>N
<8>Anton, B.P., Fomenkov, A., Roberts, R.J., Unpublished observations.
Chen, W., Pan, X., Chen, Z., Unpublished observations.
Fomenkov, A., Unpublished observations.
Xu, S.-Y., Xiao, J.-P., US Patent Office, 2000.

<1>BsrGI
<2>Bsp1407I
<3>T^GTACA
<4>
<5>Bacillus stearothermophilus GR75
<6>Z. Chen
<7>N
<8>Chen, Z.F., Pan, X.S., (1994) Chinese Sci. Bull., vol. 39, pp. 526-528.
Fang, N., Xu, S.-Y., US Patent Office, 2005.
Fomenkov, A., Unpublished observations.
Xu, S.-Y., Fang, N., Unpublished observations.

<1>BssHII
<2>BsePI
<3>G^CGCGC
<4>?(5)
<5>Bacillus stearothermophilus H3
<6>ATCC 49820
<7>JKMNQRX
<8>Fomenkov, A., Unpublished observations.
Fomenkov, A., Unpublished observations.
Langdale, J.A., Myers, P.A., Roberts, R.J., Unpublished observations.
Schildkraut, I., Greenough, L., Unpublished observations.
Schumann, J., Willert, J., Wild, C., Waler, J., Trautner, T.A., (1995) Gene, vol. 157, pp. 103-104.
Xu, S.-Y., Xiao, J.-P., Posfai, J., Maunus, R., Benner, J., (1997) Nucleic Acids Res., vol. 25, pp. 3991-3994.

<1>BssSI
<2>BsiI
<3>CACGAG(-5/-1)
<4>5(6),-1(4)
<5>Bacillus stearothermophilus 27S
<6>NEB 2935
<7>N
<8>Fomenkov, A., Unpublished observations.
Heiter, D.F., Wilson, G.G., Unpublished observations.
Pan, X.S., Chen, Z., Unpublished observations.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>BstAPI
<2>ApaBI
<3>GCANNNN^NTGC
<4>3(6)
<5>Bacillus stearothermophilus AP
<6>NEB 1778
<7>IN
<8>Abdurashitov, M.A., Belichenko, O.A., Shevchenko, A.V., Dedkov, V.S., Degtyarev, S.K., (1997) Nucleic Acids Res., vol. 25, pp. 2301-2302.
Dedkov, V.S., Gonchar, D.A., Abdurashitov, M.A., Udalyeva, S.G., Urumceva, L.A., Chernukhin, V.A., Mutylo, G.V., Degtyarev, S.K., (2015) Res. J. Pharm. Biol. Chem. Sci., vol. 6, pp. 1341-1348.
Fomenkov, A., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>BstBI
<2>AsuII
<3>TT^CGAA
<4>
<5>Bacillus stearothermophilus B225
<6>Z. Chen
<7>N
<8>Chen, Z., Kong, H., Unpublished observations.
Fomenkov, A., Unpublished observations.
Fomenkov, A., Roberts, R.J., Unpublished observations.
Morgan, R.D., Unpublished observations.
Wei, H., Unpublished observations.

<1>BstEII
<2>
<3>G^GTNACC
<4>
<5>Bacillus stearothermophilus ET
<6>ATCC 49830
<7>CJNR
<8>Chang, Z., Morgan, R., Unpublished observations.
Lautenberger, J.A., Edgell, M.H., Hutchison, C.A. III, (1980) Gene, vol. 12, pp. 171-174.
Meagher, R.B., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Morgan, R.D., Ware, J., Unpublished observations.
Ware, J., Morgan, R.D., Unpublished observations.

<1>BstNI
<2>EcoRII,PspGI
<3>CC^WGG
<4>2(4)
<5>Bacillus stearothermophilus
<6>D.G. Comb
<7>N
<8>Baryshev, M.M., Buryanov, Y.I., Kosykh, V.G., Bayev, A.A., (1989) Biokhimiia, vol. 54, pp. 1894-1903.
Schildkraut, I., Greenough, L., Comb, D., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>BstUI
<2>FnuDII
<3>CG^CG
<4>?(5)
<5>Bacillus stearothermophilus U458
<6>Z. Chen
<7>N
<8>Chen, Z., Kong, H., Unpublished observations.
Zheng, Y., Unpublished observations.

<1>BstXI
<2>
<3>CCANNNNN^NTGG
<4>3(6)
<5>Bacillus stearothermophilus X1
<6>N. Welker
<7>BIJKMNQRVXY
<8>Dedkov, V.S., Gonchar, D.A., Abdurashitov, M.A., Udalyeva, S.G., Urumceva, L.A., Chernukhin, V.A., Mutylo, G.V., Degtyarev, S.K., (2015) Res. J. Pharm. Biol. Chem. Sci., vol. 6, pp. 1341-1348.
Fomenkov, A., Unpublished observations.
Fomenkov, A., Lunnen, K.D., Zhu, Z., Anton, B.P., Wilson, G.G., Vincze, T., Roberts, R.J., (2015) Genome Announcements, vol. 3.
Fomenkov, A., Roberts, R.J., Unpublished observations.
Langdale, J.A., Myers, P.A., Roberts, R.J., Unpublished observations.
Nwankwo, D., Unpublished observations.
Skowron, P.M., Rutkowska, S.M., Harasimowicz-Slowinska, R.I., Unpublished observations.
Wise, R., Schildkraut, I., Unpublished observations.
Zhu, Z., Blanchard, A., Xu, S.-Y., Guan, S., Wei, H., Zhang, P., Sun, D., Chan, S.-h., International Patent Office, 2009.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>BstYI
<2>XhoII
<3>R^GATCY
<4>5(4)
<5>Bacillus stearothermophilus Y406
<6>Z. Chen
<7>N
<8>Chen, Z., Kong, H., (1988) FEBS Lett., vol. 234, pp. 169-171.
Fomenkov, A., Unpublished observations.
Fomenkov, A., Unpublished observations.
Strimpel, D., Stickel, S., Roberts, R.J., Unpublished observations.
Xu, S.-Y., Samuelson, J., Pelletier, J., Sibley, M., Wilson, G.G., US Patent Office, 2002.

<1>BstZ17I
<2>SnaI
<3>GTA^TAC
<4>
<5>Bacillus stearothermophilus 38M
<6>Z. Chen
<7>N
<8>Fomenkov, A., Unpublished observations.
Morgan, R.D., Unpublished observations.
Pan, X.S., Chen, Z., Unpublished observations.
Wei, H., Unpublished observations.

<1>Bsu36I
<2>SauI
<3>CC^TNAGG
<4>2(4)
<5>Bacillus subtilis 36
<6>B. Zhou
<7>N
<8>Fomenkov, A., Unpublished observations.
Fomenkov, A., Unpublished observations.
Heiter, D., Lunnen, K., Wilson, G.G., US Patent Office, 2006.
Lunnen, K.D., Heiter, D., Wilson, G.G., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Zhou, B., Li, Q., (1987) Acta Biochim. Biophys. Sin., vol. 19, pp. 537-540.

<1>BtgI
<2>DsaI
<3>C^CRYGG
<4>
<5>Bacillus thermoglucosidasius Btg
<6>NEB 1165
<7>N
<8>Ganatra, M., Krotee, S., Unpublished observations.
Pan, X.S., Polisson, C., Morgan, R., Unpublished observations.
Zhu, Z., Unpublished observations.

<1>BtgZI
<2>
<3>GCGATG(10/14)
<4>?(6)
<5>Bacillus thermoglucosidasius BtgZ
<6>NEB 1384
<7>N
<8>Anton, B.P., Clark, T., Boitano, M., Korlach, J., Roberts, R.J., Unpublished observations.
Lunnen, K., Unpublished observations.
Morgan, R.D., Unpublished observations.
Morgan, R.D., Walsh, P., US Patent Office, 2006.
Pan, X.S., Morgan, R., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>BtsI
<2>
<3>GCAGTG(2/0)
<4>
<5>Bacillus thermoglucosidasius
<6>NEB 1137
<7>N
<8>Ganatra, M., Krotee, S., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Pan, X.S., Morgan, R., Unpublished observations.
Xu, S.Y., Zhu, Z., Zhang, P., Chan, S.H., Samuelson, J.C., Xiao, J., Ingalls, D., Wilson, G.G., (2007) Nucleic Acids Res., vol. 35, pp. 4608-4618.

<1>BtsIMutI
<2>
<3>CAGTG(2/0)
<4>
<5>Bacillus thermoglucosidasius
<6>NEB 1137
<7>N
<8>Guan, S.X., Blanchard, A., Zhang, P.H., Zhu, Z.Y., (2010) PLoS ONE, vol. 5.
Zhu, Z., Unpublished observations.

<1>BtsCI
<2>FokI
<3>GGATG(2/0)
<4>
<5>Bacillus thermosphaericus
<6>NEB 1621
<7>N
<8>Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Pan, X.S., Morgan, R., Unpublished observations.
Too, P.H., Zhu, Z., Chan, S.H., Xu, S.Y., (2010) Nucleic Acids Res., vol. 38, pp. 1294-1303.
Zhu, Z., Xu, S.-Y., Unpublished observations.

<1>Cac8I
<2>
<3>GCN^NGC
<4>2(5)
<5>Clostridium acetobutylicum ABKn8
<6>G. Reysett
<7>N
<8>Azeddoug, H., Reysset, G., (1991) FEMS Microbiol. Lett., vol. 78, pp. 153-156.
Fomenkov, A., Unpublished observations.
Fomenkov, A., Vincze, T., Unpublished observations.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.

<1>I-CeuI
<2>
<3>TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
<4>
<5>Chlamydomonas eugametos
<6>C. Lemieux
<7>N
<8>Gauthier, A., Turmel, M., Lemieux, C., (1991) Curr. Genet., vol. 19, pp. 43-47.
Liu, S.L., Hessel, A., Sanderson, K.E., (1993) Proc. Natl. Acad. Sci. U. S. A., vol. 90, pp. 6874-6878.
Marshall, P., Lemieux, C., (1991) Gene, vol. 104, pp. 241-245.
Turmel, M., Boulanger, J., Schnare, M.N., Gray, M.W., Lemieux, C., (1991) J. Mol. Biol., vol. 218, pp. 293-311.

<1>ClaI
<2>BspDI
<3>AT^CGAT
<4>5(6)
<5>Caryophanon latum L
<6>ATCC 49862
<7>BKMNQRSX
<8>Longo, M.C., Smith, M.D., Chatterjee, D.K., US Patent Office, 1994.
Mayer, H., Grosschedl, R., Schutte, H., Hobom, G., (1981) Nucleic Acids Res., vol. 9, pp. 4833-4845.
McClelland, M., (1981) Nucleic Acids Res., vol. 9, pp. 6795-6804.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Slatko, B., Jack, W.E., Unpublished observations.

<1>CspCI
<2>
<3>(11/13)CAANNNNNGTGG(12/10)
<4>?(6)
<5>Citrobacter species 2144
<6>NEB 1398
<7>N
<8>Lunnen, K.D., Heiter, D.F., Benner, J.S., Wilson, G.G., Unpublished observations.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Morgan, R., Nkenfou, C.N., US Patent Office, 2005.
Morgan, R., Wilson, G., Lunnen, K., Heiter, D., Benner, J., Nkenfou, C.N., Picone, S., International Patent Office, 2005.

<1>CviAII
<2>NlaIII,FatI
<3>C^ATG
<4>2(6)
<5>Chlorella virus NC64A (PBCV-1)
<6>J.L. Van Etten
<7>N
<8>Dunigan, D.D., Blanc, G., Duncan, G.A., Gurnon, J.R., Jeanniard, A., McClung, O.W., Upton, C., Van Etten, J.L., Unpublished observations.
Gurnon, J.R., Graves, M.V., Van Etten, J.L., Unpublished observations.
Zhang, Y., Nelson, M., Nietfeldt, J.W., Burbank, D.E., Van Etten, J.L., (1992) Nucleic Acids Res., vol. 20, pp. 5351-5356.

<1>CviKI-1
<2>CviJI
<3>RG^CY
<4>
<5>Chlorella virus CA-1A
<6>J.L. Van Etten
<7>N
<8>Xu, S.-Y., Unpublished observations.

<1>M.CviPI
<2>
<3>GC
<4>2(5)
<5>Chlorella virus NYs-1
<6>J.L. Van Etten
<7>
<8>Kladde, M.P., Simpson, R.T., Xu, M., US Patent Office, 2006.
Xu, M., Kladde, M.P., Van Etten, J.L., Simpson, R.T., (1998) Nucleic Acids Res., vol. 26, pp. 3961-3966.

<1>CviQI
<2>RsaI
<3>G^TAC
<4>3(6)
<5>Chlorella virus NY-2A
<6>J.L. Van Etten
<7>N
<8>Fitzgerald, L.A., Graves, M.V., Li, X., Feldblyum, T., Nierman, W.C., Van Etten, J.L., (2007) Virology, vol. 358, pp. 472-484.
Van Etten, J.L., Unpublished observations.
Xia, Y., Narva, K.E., Van Etten, J.L., (1987) Nucleic Acids Res., vol. 15, pp. 10063.
Zhang, Y., Nelson, M., Nietfeldt, J., Xia, Y., Burbank, D., Ropp, S., Van Etten, J.L., Unpublished observations.
Zhang, Y., Nelson, M., Nietfeldt, J., Xia, Y., Burbank, D., Ropp, S., Van Etten, J.L., (1998) Virology, vol. 240, pp. 366-375.
Zhu, Z., Unpublished observations.

<1>DdeI
<2>
<3>C^TNAG
<4>1(5)
<5>Desulfovibrio desulfuricans Norway strain
<6>NCIB 83120
<7>KMNOQRSX
<8>Brooks, J.E., Howard, K.A., US Patent Office, 1994.
Gelinas, R.E., Roberts, R.J., Unpublished observations.
Howard, K.A., Card, C., Benner, J.S., Callahan, H.L., Maunus, R., Silber, K., Wilson, G., Brooks, J.E., (1986) Nucleic Acids Res., vol. 14, pp. 7939-7951.
Makula, R.A., Meagher, R.B., (1980) Nucleic Acids Res., vol. 8, pp. 3125-3131.
Sznyter, L.A., Slatko, B., Moran, L., O'Donnell, K.H., Brooks, J.E., (1987) Nucleic Acids Res., vol. 15, pp. 8249-8266.

<1>DpnI
<2>
<3>GA^TC
<4>
<5>Diplococcus pneumoniae
<6>S. Lacks
<7>BEKMNOQRSX
<8>Geier, G.E., Modrich, P., (1979) J. Biol. Chem., vol. 254, pp. 1408-1413.
Lacks, S., Greenberg, B., (1975) J. Biol. Chem., vol. 250, pp. 4060-4066.
Lacks, S., Greenberg, B., (1977) J. Mol. Biol., vol. 114, pp. 153-168.

<1>DpnII
<2>MboI,Sau3AI
<3>^GATC
<4>2(6)
<5>Diplococcus pneumoniae
<6>S. Lacks
<7>N
<8>de la Campa, A.G., Kale, P., Springhorn, S.S., Lacks, S.A., (1987) J. Mol. Biol., vol. 196, pp. 457-469.
Lacks, S., Greenberg, B., (1975) J. Biol. Chem., vol. 250, pp. 4060-4066.
Lacks, S., Greenberg, B., (1977) J. Mol. Biol., vol. 114, pp. 153-168.
Lacks, S.A., Dunn, J.J., Greenberg, B., (1982) Cell, vol. 31, pp. 327-336.
Lacks, S.A., Mannarelli, B.M., Springhorn, S.S., Greenberg, B., (1986) Cell, vol. 46, pp. 993-1000.

<1>DraI
<2>AhaIII
<3>TTT^AAA
<4>6(6)
<5>Deinococcus radiophilus
<6>ATCC 27603
<7>BIJKMNQRSVX
<8>Benner, J.S., Unpublished observations.
Kur, J., (1993) Acta Microbiol. Pol., vol. 42, pp. 145-150.
Morgan, R.D., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Purvis, I.J., Moseley, B.E.B., (1983) Nucleic Acids Res., vol. 11, pp. 5467-5474.

<1>DraIII
<2>
<3>CACNNN^GTG
<4>2(6)
<5>Deinococcus radiophilus
<6>ATCC 27603
<7>IMNV
<8>de Wit, C.M., Dekker, B.M.M., Neele, A.C., de Waard, A., (1985) FEBS Lett., vol. 180, pp. 219-223.
Grosskopf, R., Wolf, W., Kessler, C., (1985) Nucleic Acids Res., vol. 13, pp. 1517-1528.
Kong, H., Higgins, L.S., Dalton, M.A., US Patent Office, 2000.

<1>DrdI
<2>
<3>GACNNNN^NNGTC
<4>
<5>Deinococcus radiodurans
<6>NEB 479
<7>N
<8>Clark, T.A., Morgan, R.D., Unpublished observations.
Fomenkov, A., Unpublished observations.
Fomenkov, A., Luyten, Y., Vincze, T., Anton, B.P., Clark, T., Roberts, R.J., Morgan, R.D., Unpublished observations.
Polisson, C., Morgan, R.D., (1989) Nucleic Acids Res., vol. 17, pp. 3316.

<1>EaeI
<2>CfrI
<3>Y^GGCCR
<4>4(5)
<5>Enterobacter aerogenes
<6>P.R. Whitehead
<7>KN
<8>Jacobs, D., Brown, N.L., (1986) Biochem. J., vol. 238, pp. 613-616.
Lee, K.-F., Shaw, P.-C., Picone, S.J., Wilson, G.G., Lunnen, K.D., (1998) Biol. Chem., vol. 379, pp. 437-441.
Whitehead, P.R., Brown, N.L., (1983) FEBS Lett., vol. 155, pp. 97-101.

<1>EagI
<2>XmaIII
<3>C^GGCCG
<4>4(5)
<5>Enterobacter agglomerans
<6>NEB 368
<7>N
<8>Brooks, J.E., Sznyter, L.A., US Patent Office, 1991.
Morgan, R., Camp, R., Soltis, A., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Roberts, R.J., Unpublished observations.
Samuelson, J., Unpublished observations.
Xu, S.-Y., Unpublished observations.

<1>EarI
<2>Ksp632I
<3>CTCTTC(1/4)
<4>-5(6)
<5>Enterobacter aerogenes
<6>NEB 450
<7>N
<8>Lunnen, K.D., Wilson, G.G., Unpublished observations.
Morgan, R.D., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Polisson, C., Morgan, R.D., (1988) Nucleic Acids Res., vol. 16, pp. 9872.
Zhu, Z., Blanchard, A., Xu, S.-Y., Guan, S., Wei, H., Zhang, P., Sun, D., Chan, S.-h., International Patent Office, 2009.

<1>EciI
<2>
<3>GGCGGA(11/9)
<4>
<5>Escherichia coli
<6>NEB 484
<7>N
<8>Croft, R., Levin, B., Unpublished observations.
Fomenkov, A., Murray, I.A., Unpublished observations.
Murray, I.A., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>M.EcoKDam
<2>MboI,DpnII,Sau3AI
<3>GATC
<4>2(6)
<5>Escherichia coli K-12 substr. MG1655
<6>F.R. Blattner
<7>
<8>Beaulaurier, J., Zhu, S., Deikus, G., Mogno, I., Zhang, X.S., Davis-Richardson, A., Canepa, R., Triplett, E.W., Faith, J.J., Sebra, R., Schadt, E.E., Fang, G., (2017) Nat. Biotechnol., vol. 36, pp. 61-69.
Belyakin, S., Maksimov, D., Unpublished observations.
Berlin, K., Koren, S., Chin, C.-S., Drake, J., Landolin, J.M., Phillippy, A.M., Unpublished observations.
Blattner, F.R., Plunkett, G. III, Bloch, C.A., Perna, N.T., Burland, V., Riley, M., Collado-Vides, J., Glasner, J.D., Rode, C.K., Mayhew, G.F., Gregor, J., Davis, N.W., Kirkpatrick, H.A., Goeden, M.A., Rose, D.J., Mau, B., Shao, Y., (1997) Science, vol. 277, pp. 1453-1462.
Deschavanne, P., Radman, M., (1991) J. Mol. Evol., vol. 33, pp. 125-132.
Fang, G., Unpublished observations.
Geier, G.E., Modrich, P., (1979) J. Biol. Chem., vol. 254, pp. 1408-1413.
Hattman, S., Brooks, J.E., Masurekar, M., (1978) J. Mol. Biol., vol. 126, pp. 367-380.
Hulsmann, K.-H., Quaas, R., Georgalis, Y., Saenger, W., Hahn, U., (1991) Gene, vol. 98, pp. 83-88.
Lacks, S., Greenberg, B., (1977) J. Mol. Biol., vol. 114, pp. 153-168.
Laktionov, P., Maksimov, D., White-Cooper, H., Belyakin, S., Unpublished observations.
Marinus, M.G., Morris, N.R., (1973) J. Bacteriol., vol. 114, pp. 1143-1150.
Ribeiro, F.J., Przybylski, D., Yin, S., Sharpe, T., Gnerre, S., Abouelleil, A., Berlin, A.M., Montmayeur, A., Shea, T.P., Walker, B.J., Young, S.K., Russ, C., Nusbaum, C., Maccallum, I., Jaffe, D.B., (2012) Genome Res., vol. 22, pp. 2270-2277.
Schadt, E., Unpublished observations.
Sonoki, S., Higuchi, T., Hisamatsu, S., Japanese Patent Office, 2010.

<1>EcoNI
<2>
<3>CCTNN^NNNAGG
<4>2(4)
<5>Escherichia coli
<6>NEB 441
<7>N
<8>Anton, B.P., Clark, T., Boitano, M., Korlach, J., Roberts, R.J., Unpublished observations.
Hall, D., Morgan, R., Unpublished observations.
Morgan, R.D., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Zhu, Z., Unpublished observations.
Zhu, Z., Xu, S.-Y., Unpublished observations.

<1>EcoO109I
<2>DraII
<3>RG^GNCCY
<4>5(5)
<5>Escherichia coli H709c
<6>I. Orskov
<7>BJKN
<8>Kita, K., Tsuda, J., Kato, T., Okamoto, K., Yanase, H., Tanaka, M., (1999) J. Bacteriol., vol. 181, pp. 6822-6827.
Kita, K., Tsuda, J., Nishigaki, R., (2001) Biosci. Biotechnol. Biochem., vol. 65, pp. 2512-2518.
Mise, K., Nakajima, K., (1985) Gene, vol. 36, pp. 363-367.
Xu, S.-Y., Unpublished observations.

<1>EcoP15I
<2>
<3>CAGCAG(25/27)
<4>5(6)
<5>Escherichia coli P15
<6>W. Arber
<7>N
<8>Ahmad, I., Rao, D.N., (1994) Gene, vol. 142, pp. 67-71.
Hadi, S.M., Bachi, B., Shepherd, J.C.W., Yuan, R., Ineichen, K., Bickle, T.A., (1979) J. Mol. Biol., vol. 134, pp. 655-666.
Meisel, A., Kruger, D.H., Bickle, T.A., (1991) Nucleic Acids Res., vol. 19, pp. 3997.
Moencke-Buchner, E., Mackeldanz, P., Krueger, D.H., Reuter, M., (2004) J. Biotechnol., vol. 114, pp. 99-106.
Reiser, J., Yuan, R., (1977) J. Biol. Chem., vol. 252, pp. 451-456.
Wagenfuhr, K., Pieper, S., Mackeldanz, P., Linscheid, M., Kruger, D.H., Reuter, M., (2007) J. Mol. Biol., vol. 366, pp. 93-102.

<1>EcoRI
<2>
<3>G^AATTC
<4>3(6)
<5>Escherichia coli RY13
<6>R.N. Yoshimori
<7>BCIJKMNOQRSVXY
<8>Albertsen, H.M., Le Paslier, D., Abderrahim, H., Dausset, J., Cann, H., Cohen, D., (1989) Nucleic Acids Res., vol. 17, pp. 808.
Dugaiczyk, A., Hedgpeth, J., Boyer, H.W., Goodman, H.M., (1974) Biochemistry, vol. 13, pp. 503-512.
Forrow, S., Lee, M., Souhami, R.L., Hartley, J.A., (1994) ACS Abstracts, vol. 208, pp. 97.
Greene, P.J., Betlach, M.C., Boyer, H.W., Goodman, H.M., (1974) Methods Mol. Biol., vol. 7, pp. 87-105.
Hedgpeth, J., Goodman, H.M., Boyer, H.W., (1972) Proc. Natl. Acad. Sci. U. S. A., vol. 69, pp. 3448-3452.
Pingoud, A., Alves, J., Fliess, A., Geiger, R., Rueter, T., Wolfes, H., (1987) Biol. Chem. Hoppe Seyler, vol. 368, pp. 1093.
Tanaka, M., Japanese Patent Office, 2002.
Winkler, F.K., (1994) J. Mol. Recognit., vol. 6, pp. 9.

<1>EcoRV
<2>
<3>GAT^ATC
<4>2(6)
<5>Escherichia coli J62 pLG74
<6>L.I. Glatman
<7>BCIJKMNOQRSVX
<8>Baldwin, G.S., Halford, S.E., (1994) Biochem. Soc. Trans., vol. 22, pp. 300S.
Erskine, S.G., Halford, S.E., (1994) Biochem. Soc. Trans., vol. 22, pp. 299s.
Forrow, S., Lee, M., Souhami, R.L., Hartley, J.A., (1994) ACS Abstracts, vol. 208, pp. 97.
Kholmina, G.V., Rebentish, B.A., Skoblov, Y.S., Mironov, A.A., Yankovskii, N.K., Kozlov, Y.I., Glatmann, L.I., Moroz, A.F., Debabov, V.G., (1980) Dokl. Akad. Nauk., vol. 253, pp. 495-497.
Nwosu, V.U., Connolly, B.A., Halford, S.E., Garnett, J., (1988) Nucleic Acids Res., vol. 16, pp. 3705-3720.
Schildkraut, I., Banner, C.D.B., Rhodes, C.S., Parekh, S., (1984) Gene, vol. 27, pp. 327-329.
Vipond, I.B., Moon, B.J., Halford, S.E., (1994) Biochem. Soc. Trans., vol. 22, pp. 301S.
Winkler, F.K., (1994) J. Mol. Recognit., vol. 6, pp. 9.
Zakharova, M.V., Unpublished observations.

<1>Eco53kI
<2>SacI
<3>GAG^CTC
<4>
<5>Escherichia coli 53k
<6>A.S. Solonin
<7>N
<8>Chan, S.-H., Unpublished observations.
Denjmukhametov, M.M., Zakharova, M.V., Kravets, A.N., Pertsev, A.V., Sineva, E.V., Repik, A.V., Beletskaya, I.V., Gromova, E.S., Solonin, A.S., (1997) Mol. Biol. (Mosk), vol. 31, pp. 831-838.

<1>Esp3I
<2>BsmBI
<3>CGTCTC(1/5)
<4>4(5),-4(6)
<5>Erwinia species RFL3
<6>A. Janulaitis
<7>BN
<8>Bitinaite, J., Grigaite, R., Maneliene, Z., Butkus, V., Janulaitis, A., (1991) Nucleic Acids Res., vol. 19, pp. 5076.
Bitinaite, J., Maneliene, Z., Menkevicius, S., Klimasauskas, S., Butkus, V., Janulaitis, A., (1992) Nucleic Acids Res., vol. 20, pp. 4981-4985.

<1>FatI
<2>NlaIII,CviAII
<3>^CATG
<4>1(5)
<5>Flavobacterium aquatile NL3
<6>NEB 1779
<7>IN
<8>Dedkov, V.S., Chernukhin, V.A., Gonchar, D.A., Abdurashitov, M.A., Degtyarev, S.K., Unpublished observations.
Dedkov, V.S., Gonchar, D.A., Abdurashitov, M.A., Udalyeva, S.G., Urumceva, L.A., Chernukhin, V.A., Mutylo, G.V., Degtyarev, S.K., Unpublished observations.
Dedkov, V.S., Gonchar, D.A., Abdurashitov, M.A., Udalyeva, S.G., Urumceva, L.A., Chernukhin, V.A., Mutylo, G.V., Degtyarev, S.K., (2015) Res. J. Pharm. Biol. Chem. Sci., vol. 6, pp. 1341-1348.
Dedkov, V.S., Kileva, E.V., Popichenko, D.V., Degtyarev, S.K., (2002) Biotekhnologiya, vol. 5, pp. 3-7.
Fomenkov, A., Unpublished observations.
Morgan, R.D., Unpublished observations.

<1>FauI
<2>
<3>CCCGC(4/6)
<4>
<5>Flavobacterium aquatile
<6>NEB 1780
<7>IN
<8>Dedkov, V.S., Gonchar, D.A., Abdurashitov, M.A., Udalyeva, S.G., Urumceva, L.A., Chernukhin, V.A., Mutylo, G.V., Degtyarev, S.K., (2015) Res. J. Pharm. Biol. Chem. Sci., vol. 6, pp. 1341-1348.
Degtyarev, S.K., Unpublished observations.
Degtyarev, S.K., Kolyhalov, A.A., Rechkunova, N.I., Dedkov, V.S., (1989) Bioorg. Khim., vol. 15, pp. 130-132.
Fomenkov, A., Unpublished observations.

<1>Fnu4HI
<2>
<3>GC^NGC
<4>2(5)
<5>Fusobacterium nucleatum 4H
<6>M. Smith
<7>N
<8>Fomenkov, A., Unpublished observations.
Forrow, S., Lee, M., Souhami, R.L., Hartley, J.A., (1994) ACS Abstracts, vol. 208, pp. 97.
Leung, D.W., Lui, A.C.P., Merilees, H., McBride, B.C., Smith, M., (1979) Nucleic Acids Res., vol. 6, pp. 17-25.
Morgan, R.D., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Vaisvila, R., Unpublished observations.

<1>FokI
<2>BtsCI
<3>GGATG(9/13)
<4>3(6),-2(6)
<5>Flavobacterium okeanokoites
<6>IFO 12536
<7>BIJKMNVXY
<8>Cermak, T., Doyle, E.L., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Baller, J.A., Somia, N.V., Bogdanove, A.J., Voytas, D.F., (2011) Nucleic Acids Res., vol. 39.
Dahlem, T.J., Hoshijima, K., Jurynec, M.J., Gunther, D., Starker, C.G., Locke, A.S., Weis, A.M., Voytas, D.F., Grunwald, D.J., (2012) PLoS Genet., vol. 8.
de Pater, S., Pinas, J.E., Hooykaas, P.J.J., van der Zaal, B.J., Unpublished observations.
Guo, J., Gaj, T., Barbas, C.F.I.I.I., (2010) J. Mol. Biol., vol. 400, pp. 96-107.
Kuehn, R., Wurst, W., Meyer, M., European Patent Office, 2011.
Landry, D., Looney, M.C., Feehery, G.R., Slatko, B.E., Jack, W.E., Schildkraut, I., Wilson, G.G., (1989) Gene, vol. 77, pp. 1-10.
Li, L., Wu, L.P., Clarke, R., Chandrasegaran, S., (1993) Gene, vol. 133, pp. 79-84.
Matvienko, N.I., Kramarov, V.M., Irismetov, A.A., (1985) Bioorg. Khim., vol. 11, pp. 953-956.
Posfai, G., Szybalski, W., (1988) Gene, vol. 69, pp. 147-151.
Posfai, G., Szybalski, W., (1988) Gene, vol. 74, pp. 179-181.
Steenstrup, T.D., Norby, P.L., International Patent Office, 2007.
Sugisaki, H., Kanazawa, S., (1981) Gene, vol. 16, pp. 73-78.
Sugisaki, H., Kita, K., Takanami, M., (1989) J. Biol. Chem., vol. 264, pp. 5757-5761.
Takasu, Y., Sajwan, S., Daimon, T., Osanai-Futahashi, M., Uchino, K., Sezutsu, H., Tamura, T., Zurovec, M., (2013) PLoS ONE, vol. 8.
Vainstein, A., Zuker, A., International Patent Office, 2009.
Vainstein, A., Zuker, A., International Patent Office, 2011.

<1>FseI
<2>
<3>GGCCGG^CC
<4>?(5)
<5>Frankia species Eul1b
<6>NRRL 18528
<7>N
<8>Morgan, R.D., Unpublished observations.
Morgan, R.D., US Patent Office, 1996.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Nelson, J.M., Miceli, S.M., Lechevalier, M.P., Roberts, R.J., (1990) Nucleic Acids Res., vol. 18, pp. 2061-2064.

<1>FspI
<2>MstI
<3>TGC^GCA
<4>?(5)
<5>Fischerella species
<6>ATCC 29114
<7>JN
<8>Christ, C., Ingalls, D., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Szekeres, M., Unpublished observations.
Ware, J., Meda, M., Mazzola, L., Wilson, G.G., Unpublished observations.
Wilson, G.G., Meda, M.M., US Patent Office, 1993.

<1>FspEI
<2>
<3>CC(12/16)
<4>
<5>Frankia species EAN1pec
<6>L.S. Tisa
<7>N
<8>Zheng, Y., Cohen-Karni, D., Xu, D., Chin, H.G., Wilson, G., Pradhan, S., Roberts, R.J., (2010) Nucleic Acids Res., vol. 38, pp. 5527-5534.
Zheng, Y., Roberts, R.J., International Patent Office, 2010.

<1>HaeII
<2>
<3>RGCGC^Y
<4>?(5)
<5>Haemophilus aegyptius
<6>ATCC 11116
<7>JKNR
<8>Lunnen, K.D., Barsomian, J.M., Camp, R.R., Card, C.O., Chen, S.-Z., Croft, R., Looney, M.C., Meda, M.M., Moran, L.S., Nwankwo, D.O., Slatko, B.E., Van Cott, E.M., Wilson, G.G., (1988) Gene, vol. 74, pp. 25-32.
Muzny, D. et al., Unpublished observations.
Puzio, P., Blau, A., Plesch, G., Kamlage, B., Looser, R., Schmitz, O., Wendel, B., European Patent Office, 2009.
Roberts, R.J., Breitmeyer, J.B., Tabachnik, N.F., Myers, P.A., (1975) J. Mol. Biol., vol. 91, pp. 121-123.
Stein, D.C., Gunn, J.S., Piekarowicz, A., (1998) Biol. Chem., vol. 379, pp. 575-578.
Tu, C.-P.D., Roychoudhury, R., Wu, R., (1976) Biochem. Biophys. Res. Commun., vol. 72, pp. 355-362.

<1>HaeIII
<2>
<3>GG^CC
<4>3(5)
<5>Haemophilus aegyptius
<6>ATCC 11116
<7>BIJKMNOQRSX
<8>Bron, S., Murray, K., (1975) Mol. Gen. Genet., vol. 143, pp. 25-33.
Mann, M.B., Smith, H.O., (1977) Nucleic Acids Res., vol. 4, pp. 4211-4221.
Middleton, J.H., Edgell, M.H., Hutchison, C.A. III, (1972) J. Virol., vol. 10, pp. 42-50.
Muzny, D. et al., Unpublished observations.
Puzio, P., Blau, A., Plesch, G., Kamlage, B., Looser, R., Schmitz, O., Wendel, B., European Patent Office, 2009.

<1>HgaI
<2>
<3>GACGC(5/10)
<4>3(5)
<5>Haemophilus gallinarum
<6>ATCC 14385
<7>IN
<8>Brown, N.L., Smith, M., (1977) Proc. Natl. Acad. Sci. U. S. A., vol. 74, pp. 3213-3216.
Dedkov, V.S., Gonchar, D.A., Abdurashitov, M.A., Udalyeva, S.G., Urumceva, L.A., Chernukhin, V.A., Mutylo, G.V., Degtyarev, S.K., (2015) Res. J. Pharm. Biol. Chem. Sci., vol. 6, pp. 1341-1348.
Landry, D., Barsomian, J.M., Feehery, G.R., Wilson, G.G., (1992) Methods Enzymol., vol. 216, pp. 244-259.
Lunnen, K.D., Barsomian, J.M., Camp, R.R., Card, C.O., Chen, S.-Z., Croft, R., Looney, M.C., Meda, M.M., Moran, L.S., Nwankwo, D.O., Slatko, B.E., Van Cott, E.M., Wilson, G.G., (1988) Gene, vol. 74, pp. 25-32.
Moses, P., Horiuchi, K., (1979) J. Mol. Biol., vol. 135, pp. 517-524.
Sugisaki, H., (1978) Gene, vol. 3, pp. 17-28.
Sugisaki, H., Yamamoto, K., Takanami, M., (1991) J. Biol. Chem., vol. 266, pp. 13952-13957.
Takanami, M., (1974) Methods Mol. Biol., vol. 7, pp. 113-133.
Wilson, G.G., Murray, N.E., (1991) Annu. Rev. Genet., vol. 25, pp. 585-627.

<1>HhaI
<2>HinP1I
<3>GCG^C
<4>2(5)
<5>Haemophilus haemolyticus
<6>ATCC 10014
<7>BJKNQRX
<8>Mann, M.B., Smith, H.O., (1979) Proceedings of the Conference on Transmethylation, ed. Usdin, E., Borchardt, R.T., Creveling, C.R. (Elsevier North Holland, New York), vol. 0, pp. 483-492.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Roberts, R.J., (1994) Angew. Chem. Int. Ed. Engl., vol. 33, pp. 1222-1228.
Roberts, R.J., Myers, P.A., Morrison, A., Murray, K., (1976) J. Mol. Biol., vol. 103, pp. 199-208.
Som, S., Friedman, S., (1994) J. Biol. Chem., vol. 269, pp. 25986-25991.

<1>HinP1I
<2>HhaI
<3>G^CGC
<4>2(5)
<5>Haemophilus influenzae P1
<6>S. Shen
<7>N
<8>Barsomian, J.M., Wilson, G.G., US Patent Office, 1991.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Puzio, P., Blau, A., Plesch, G., Kamlage, B., Looser, R., Schmitz, O., Wendel, B., European Patent Office, 2009.
Shen, S., Li, Q., Yan, P., Zhou, B., Ye, S., Lu, Y., Wang, D., (1980) Sci. Sin., vol. 23, pp. 1435-1442.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>HincII
<2>HindII
<3>GTY^RAC
<4>5(6)
<5>Haemophilus influenzae Rc
<6>ATCC 49699
<7>BJKNOQRX
<8>Benner, J.S., Rees, P.A., European Patent Office, 1995.
Ii, J.S.B., Rees, P.A., Japanese Patent Office, 1998.
Ito, H., Sadaoka, A., Japanese Patent Office, 1991.
Ito, H., Sadaoka, A., Kotani, H., Hiraoka, N., Nakamura, T., (1990) Nucleic Acids Res., vol. 18, pp. 3903-3911.
Landy, A., Ruedisueli, E., Robinson, L., Foeller, C., Ross, W., (1974) Biochemistry, vol. 13, pp. 2134-2142.
Waite-Rees, P.A., Nwankwo, D., Moran, L., Slatko, B.S., Wilson, G.G., Unpublished observations.

<1>HindIII
<2>
<3>A^AGCTT
<4>1(6)
<5>Haemophilus influenzae Rd
<6>ATCC 51907
<7>BCIJKMNOQRSVXY
<8>Fleischmann, R.D. et al., (1995) Science, vol. 269, pp. 496-512.
Fleischmann, R.D., Adams, M.D., White, O., Smith, H.O., Venter, J.C., Japanese Patent Office, 2004.
Fleischmann, R.D., Adams, M.D., White, O., Smith, H.O., Venter, J.C., US Patent Office, 2003.
Fleischmann, R.D., Adams, M.D., White, O., Smith, H.O., Venter, J.C., US Patent Office, 2005.
Fomenkov, A., Redfield, R., Mell, J., Roberts, R.J., Unpublished observations.
Old, R., Murray, K., Roizes, G., (1975) J. Mol. Biol., vol. 92, pp. 331-339.
Roy, P.H., Smith, H.O., (1973) J. Mol. Biol., vol. 81, pp. 427-444.
Roy, P.H., Smith, H.O., (1973) J. Mol. Biol., vol. 81, pp. 445-459.

<1>HinfI
<2>
<3>G^ANTC
<4>2(6)
<5>Haemophilus influenzae Rf (strain Dingles)
<6>G. Leidy
<7>BCIJKMNOQRVXY
<8>Bassing, C.H., Kim, Y.-G., Li, L., Chandrasegaran, S., (1992) Gene, vol. 113, pp. 83-88.
Chandrasegaran, S., Lunnen, K.D., Smith, H.O., Wilson, G.G., (1988) Gene, vol. 70, pp. 387-392.
Dedkov, V.S., Gonchar, D.A., Abdurashitov, M.A., Udalyeva, S.G., Urumceva, L.A., Chernukhin, V.A., Mutylo, G.V., Degtyarev, S.K., (2015) Res. J. Pharm. Biol. Chem. Sci., vol. 6, pp. 1341-1348.
Huang, L.-H., Farnet, C.M., Ehrlich, K.C., Ehrlich, M., (1982) Nucleic Acids Res., vol. 10, pp. 1579-1591.
Hutchison, C.A., Barrell, B.G., Unpublished observations.
Middleton, J.H., Stankus, P.V., Edgell, M.H., Hutchison, C.A. III, Unpublished observations.
Murray, K., Morrison, A., Unpublished observations.
Stickel, S.K., Roberts, R.J., Unpublished observations.
Treml, S., Draveling, C., Huang, C., Heaster, J., Walker, D., DiFrancesco, R., Jolly, J., (1994) Clin. Chem., vol. 40, pp. 1092.
Wilson, G.G., US Patent Office, 1993.

<1>HpaI
<2>
<3>GTT^AAC
<4>5(6)
<5>Haemophilus parainfluenzae
<6>ATCC 49669
<7>BCIJKMNQRSVX
<8>Benner, J.S., Rees, P., European Patent Office, 1995.
Benner, J.S., Rees, P., US Patent Office, 1994.
Fomenkov, A., Unpublished observations.
Fomenkov, A., Unpublished observations.
Garfin, D.E., Goodman, H.M., (1974) Biochem. Biophys. Res. Commun., vol. 59, pp. 108-116.
Ito, H., Shimado, H., Kimizuka, F., Kato, I., Japanese Patent Office, 1993.
Sharp, P.A., Sugden, B., Sambrook, J., (1973) Biochemistry, vol. 12, pp. 3055-3063.
Yoo, O.J., Dwyer-Hallquist, P., Agarwal, K.L., (1982) Nucleic Acids Res., vol. 10, pp. 6511-6519.

<1>HpaII
<2>MspI
<3>C^CGG
<4>2(5)
<5>Haemophilus parainfluenzae
<6>ATCC 49669
<7>BINQRVX
<8>Anton, B.P., Fomenkov, A., Roberts, R.J., Unpublished observations.
Butkus, V., Petrauskiene, L., Maneliene, Z., Klimasauskas, S., Laucys, V., Janulaitis, A., (1987) Nucleic Acids Res., vol. 15, pp. 7091-7102.
Chatterjee, D.K., US Patent Office, 1993.
Fomenkov, A., Unpublished observations.
Fomenkov, A., Unpublished observations.
Garfin, D.E., Goodman, H.M., (1974) Biochem. Biophys. Res. Commun., vol. 59, pp. 108-116.
Kulakauskas, S., Barsomian, J.M., Lubys, A., Roberts, R.J., Wilson, G.G., (1994) Gene, vol. 142, pp. 9-15.
Mann, M.B., Smith, H.O., (1977) Nucleic Acids Res., vol. 4, pp. 4211-4221.
Puzio, P., Blau, A., Plesch, G., Kamlage, B., Looser, R., Schmitz, O., Wendel, B., European Patent Office, 2009.
Sharp, P.A., Sugden, B., Sambrook, J., (1973) Biochemistry, vol. 12, pp. 3055-3063.
Som, S., Friedman, S., (1994) J. Biol. Chem., vol. 269, pp. 25986-25991.

<1>HphI
<2>
<3>GGTGA(8/7)
<4>5(6)
<5>Haemophilus parahaemolyticus
<6>ATCC 49700
<7>BN
<8>Daniels, J.S., Gates, K.S., (1994) ACS Abstracts, vol. 208, pp. 66.
Kleid, D., Humayun, Z., Jeffrey, A., Ptashne, M., (1976) Proc. Natl. Acad. Sci. U. S. A., vol. 73, pp. 293-297.
Lubys, A., Lubiene, J., Kulakauskas, S., Stankevicius, K., Timinskas, A., Janulaitis, A., (1996) Nucleic Acids Res., vol. 24, pp. 2760-2766.
Middleton, J.H., Stankus, P.V., Edgell, M.H., Hutchison, C.A. III, Unpublished observations.
Nelson, M., Unpublished observations.

<1>Hpy99I
<2>
<3>CGWCG^
<4>4(4)
<5>Helicobacter pylori J99
<6>R.A. Alm
<7>N
<8>Alm, R.A., Ling, L.-S.L., Moir, D.T., King, B.L., Brown, E.D., Doig, P.C., Smith, D.R., Noonan, B., Guild, B.C., deJonge, B.L., Carmel, G., Tummino, P.J., Caruso, A., Uria-Nickelsen, M., Mills, D.M., Ives, C., Gibson, R., Merberg, D., Mills, S., (1999) Nature, vol. 397, pp. 176-180.
Beaulaurier, J., Zhang, X.S., Zhu, S., Sebra, R., Rosenbluh, C., Deikus, G., Shen, N., Munera, D., Waldor, M.K., Chess, A., Blaser, M.J., Schadt, E.E., Fang, G., (2015) Nat. Commun., vol. 6, pp. 7438.
Krebes, J., Morgan, R.D., Bunk, B., Sproeer, C., Luong, K., Parusel, R., Anton, B.P., Koenig, C., Josenhans, C., Overmann, J., Roberts, R.J., Korlach, J., Suerbaum, S., (2014) Nucleic Acids Res., vol. 42, pp. 2415-2432.
Lin, L., Porter, N., Kong, H., Unpublished observations.
Morgan, R.D., Xu, Q., International Patent Office, 2001.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>Hpy166II
<2>MjaIV
<3>GTN^NAC
<4>
<5>Helicobacter pylori J166
<6>M.J. Blaser
<7>N
<8>Linz, B., Windsor, H.M., McGraw, J.J., Hansen, L.M., Gajewski, J.P., Tomsho, L.P., Hake, C.M., Solnick, J.V., Schuster, S.C., Marshall, B.J., (2014) Nat. Commun., vol. 5, pp. 4165.
Slatko, B., Morgan, R.D., Unpublished observations.
Xu, Q., Morgan, R., Blaser, M., Unpublished observations.
Zhu, Z., Unpublished observations.
Zhu, Z., Blanchard, A., Xu, S.-Y., Guan, S., Wei, H., Zhang, P., Sun, D., Chan, S.-h., International Patent Office, 2009.

<1>Hpy188I
<2>
<3>TCN^GA
<4>5(6)
<5>Helicobacter pylori J188
<6>M.J. Blaser
<7>N
<8>Xu, Q., Stickel, S., Roberts, R.J., Blaser, M.J., Morgan, R.D., (2000) J. Biol. Chem., vol. 275, pp. 17086-17093.

<1>Hpy188III
<2>Hpy178III
<3>TC^NNGA
<4>
<5>Helicobacter pylori J188
<6>M.J. Blaser
<7>N
<8>Morgan, R.D., Xu, Q., US Patent Office, 2001.
Xu, Q., Morgan, R.D., Unpublished observations.

<1>HpyAV
<2>Hin4II
<3>CCTTC(6/5)
<4>2(5),-3(6)
<5>Helicobacter pylori 26695
<6>D.E. Berg
<7>N
<8>Chan, S.H., Opitz, L., Higgins, L., O'loane, D., Xu, S.-Y., (2010) PLoS ONE, vol. 5.
Higgins, L., Morgan, R.D., Kong, H., Unpublished observations.
Kleanthous, H., Garawi, A.A., Miller, C., Tomb, J.F., Oomen, R.P., Japanese Patent Office, 2001.
Kong, H., Sears, L., Unpublished observations.
Krebes, J., Morgan, R.D., Bunk, B., Sproeer, C., Luong, K., Parusel, R., Anton, B.P., Koenig, C., Josenhans, C., Overmann, J., Roberts, R.J., Korlach, J., Suerbaum, S., (2014) Nucleic Acids Res., vol. 42, pp. 2415-2432.
Kumar, S., Karmakar, B.C., Nagarajan, D., Mukhopadhyay, A.K., Morgan, R.D., Rao, D.N., (2018) Nucleic Acids Res., vol. 46, pp. 3429-3445.
Lin, L.-F., Kong, H., Unpublished observations.
Tomb, J.-F. et al., (1997) Nature, vol. 388, pp. 539-547.
Xu, S.-Y., Unpublished observations.

<1>HpyCH4III
<2>Tsp4CI
<3>ACN^GT
<4>
<5>Helicobacter pylori CH4
<6>M.J. Blaser
<7>N
<8>Morgan, R.D., Xu, Q., International Patent Office, 2001.
Zhu, Z., Unpublished observations.

<1>HpyCH4IV
<2>MaeII
<3>A^CGT
<4>2(5)
<5>Helicobacter pylori CH4
<6>M.J. Blaser
<7>N
<8>Morgan, R.D., Xu, Q., US Patent Office, 2001.

<1>HpyCH4V
<2>CviRI
<3>TG^CA
<4>
<5>Helicobacter pylori CH4
<6>M.J. Blaser
<7>N
<8>Morgan, R.D., Xu, Q., US Patent Office, 2000.

<1>M.HsaDnmt1A
<2>
<3>?
<4>?(5)
<5>Homo sapiens
<6>S.B. Baylin
<7>
<8>Nagase, T., Yamakawa, H., Tadokoro, S., Nakajima, D., Inoue, S., Yamaguchi, K., Itokawa, Y., Kikuno, R.F., Koga, H., Ohara, O., Unpublished observations.
Totoki, Y., Toyoda, A., Takeda, T., Sakaki, Y., Tanaka, A., Yokoyama, S., Ohara, O., Nagase, T., Kikuno, R., Unpublished observations.
Yen, R.-W.C., Vertino, P.M., Nelkin, B.D., Yu, J.J., El-Deiry, W., Cumaraswamy, A., Lennon, G.G., Trask, B.J., Celano, P., Baylin, S.B., (1992) Nucleic Acids Res., vol. 20, pp. 2287-2291.

<1>KasI
<2>NarI,PluTI,SfoI
<3>G^GCGCC
<4>?(5)
<5>Kluyvera ascorbata
<6>NEB 593
<7>N
<8>Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Polisson, C., Barsomian, J.M., US Patent Office, 1992.
Roberts, R.J., Unpublished observations.
Vaisvila, R., Unpublished observations.

<1>KpnI
<2>Acc65I
<3>GGTAC^C
<4>4(6)
<5>Klebsiella pneumoniae OK8
<6>ATCC 49790
<7>BCIJKMNOQRSVXY
<8>Chatterjee, D., Longo, M., Flynn, E., Oberfelder, R., Japanese Patent Office, 2001.
Chatterjee, D., Longo, M., Flynn, E., Oberfelder, R., US Patent Office, 2004.
Chatterjee, D.K., Longo, M., Flynn, E., Oberfelder, R., US Patent Office, 2007.
Kiss, A., Finta, C., Venetianer, P., (1991) Nucleic Acids Res., vol. 19, pp. 3460.
Nagamalleswari, E., Nagaraja, V., (2017) Genome Announcements, vol. 5.
Oberfelder, R., Longo, M., Flynn, E., Chatterjee, D., European Patent Office, 2008.
Smith, D.I., Blattner, F.R., Davies, J., (1976) Nucleic Acids Res., vol. 3, pp. 343-353.
Tomassini, J., Roychoudhury, R., Wu, R., Roberts, R.J., (1978) Nucleic Acids Res., vol. 5, pp. 4055-4064.
Xu, S.-Y., Unpublished observations.

<1>LpnPI
<2>
<3>CCDG(10/14)
<4>
<5>Legionella pneumophila subsp. pneumophila Philadelphia 1
<6>J.J. Russo
<7>N
<8>Chien, M. et al., (2004) Science, vol. 305, pp. 1966-1968.
Cohen-Karni, D., Xu, D., Apone, L., Fomenkov, A., Sun, Z.Y., Davis, P.J., Kinney, S.R.M., Yamada-Mabuchi, M., Xu, S.Y., Davis, T., Pradhan, S., Roberts, R.J., Zheng, Y., (2011) Proc. Natl. Acad. Sci. U. S. A., vol. 108, pp. 11040-11045.
Zheng, Y., Roberts, R.J., International Patent Office, 2010.

<1>MboI
<2>DpnII,Sau3AI
<3>^GATC
<4>2(6)
<5>Moraxella bovis ATCC 10900
<6>ATCC 10900
<7>BCKNQRXY
<8>Anton, B.P., Brooks, J.E., Unpublished observations.
Fomenkov, A., Unpublished observations.
Gelinas, R.E., Myers, P.A., Roberts, R.J., (1977) J. Mol. Biol., vol. 114, pp. 169-179.
Huang, L.-H., Farnet, C.M., Ehrlich, K.C., Ehrlich, M., (1982) Nucleic Acids Res., vol. 10, pp. 1579-1591.
Ueno, T., Ito, H., Kimizuka, F., Kotani, H., Nakajima, K., (1993) Nucleic Acids Res., vol. 21, pp. 2309-2313.
Ueno, T., Ito, H., Kotani, H., Nakajima, K., Japanese Patent Office, 1993.

<1>MboII
<2>
<3>GAAGA(8/7)
<4>?(4),-2(4)
<5>Moraxella bovis ATCC 10900
<6>ATCC 10900
<7>BIJKNQRVX
<8>Brown, N.L., Hutchison, C.A. III, Smith, M., (1980) J. Mol. Biol., vol. 140, pp. 143-148.
Chang, Z., Morgan, R., Unpublished observations.
Endow, S.A., (1977) J. Mol. Biol., vol. 114, pp. 441-449.
Fomenkov, A., Unpublished observations.
Furmanek-Blaszk, B., Boratynski, R., Zolcinska, N., Sektas, M., (2009) Microbiology, vol. 155, pp. 1111-1121.
Gelinas, R.E., Myers, P.A., Roberts, R.J., (1977) J. Mol. Biol., vol. 114, pp. 169-179.
McClelland, M., Nelson, M., Cantor, C.R., (1985) Nucleic Acids Res., vol. 13, pp. 7171-7182.

<1>MfeI
<2>
<3>C^AATTG
<4>3(6)
<5>Mycoplasma fermentans
<6>N.F. Halden
<7>IN
<8>Fomenkov, A., Fei, L., Sun, D., Roberts, R.J., Unpublished observations.
Halden, N.F., Wolf, J.B., Cross, S.L., Leonard, W.J., (1988) Clin. Res., vol. 36, pp. 404a.
Halden, N.F., Wolf, J.B., Leonard, W.J., (1989) Nucleic Acids Res., vol. 17, pp. 3491-3499.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Stickel, S.K., Roberts, R.J., Unpublished observations.
Xu, S.-Y., Unpublished observations.
Zhu, Z., Blanchard, A., Xu, S.-Y., Guan, S., Wei, H., Zhang, P., Sun, D., Chan, S.-h., International Patent Office, 2009.

<1>MluI
<2>
<3>A^CGCGT
<4>?(4)
<5>Micrococcus luteus
<6>IFO 12992
<7>BIJKMNOQRSVX
<8>Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Stickel, S.K., Roberts, R.J., Unpublished observations.
Sugisaki, H., Kanazawa, S., (1981) Gene, vol. 16, pp. 73-78.
Xiao, J., Nwankwo, D.O., Xu, S.-Y., Unpublished observations.
Xiao, J.-P., Nwankwo, D.O., Xu, S.-Y., Unpublished observations.

<1>MluCI
<2>TspEI
<3>^AATT
<4>
<5>Micrococcus luteus
<6>NEB 1223
<7>N
<8>Lunnen, K.D., Wilson, G.G., Unpublished observations.
Nkenfou, C., Polisson, C., Nkenfou, J., Notedji, A., Morgan, R., Unpublished observations.
Stickel, S.K., Unpublished observations.

<1>MlyI
<2>PleI
<3>GAGTC(5/5)
<4>2(6)
<5>Micrococcus lylae
<6>NBL 2048
<7>N
<8>Eastlake, P., Unpublished observations.
Fomenkov, A., Unpublished observations.
Fomenkov, A., Unpublished observations.
Kong, H., Unpublished observations.
Kong, H., Higgins, L.S., US Patent Office, 2002.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>MmeI
<2>
<3>TCCRAC(20/18)
<4>5(6)
<5>Methylophilus methylotrophus
<6>W.J. Brammar
<7>NX
<8>Boyd, A.C., Charles, I.G., Keyte, J.W., Brammar, W.J., (1986) Nucleic Acids Res., vol. 14, pp. 5255-5274.
Morgan, R.D., Unpublished observations.
Tucholski, J., Zmijewski, J.W., Podhajska, A.J., (1998) Gene, vol. 223, pp. 293-302.
Usuda, Y., Nishio, Y., Matsui, K., Sugimoto, S., Koseki, K., US Patent Office, 2008.

<1>MnlI
<2>
<3>CCTC(7/6)
<4>-2(6)
<5>Moraxella nonliquefaciens
<6>ATCC 17953
<7>BINQVX
<8>Brinkley, P., Bautista, D.S., Graham, F.L., (1991) Gene, vol. 100, pp. 267-268.
Harasimowicz-Slowinska, R.I., Skowron, P.M., Unpublished observations.
Kriukiene, E., Lubiene, J., Lagunavicius, A., Lubys, A., (2005) Biochim. Biophys. Acta, vol. 1751, pp. 194-204.
Schildkraut, I., Unpublished observations.
Zabeau, M., Greene, R., Myers, P.A., Roberts, R.J., Unpublished observations.

<1>MscI
<2>BalI
<3>TGG^CCA
<4>
<5>Micrococcus species
<6>NEB 502
<7>NO
<8>Meda, M., Wilson, G.G., Slatko, B.E., Unpublished observations.
Meda, M.M., Wilson, G.G., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Polisson, C., (1989) Nucleic Acids Res., vol. 17, pp. 5858.

<1>MseI
<2>
<3>T^TAA
<4>4(6)
<5>Micrococcus species
<6>NEB 446
<7>N
<8>Morgan, R.D., Unpublished observations.
Morgan, R.D., (1988) Nucleic Acids Res., vol. 16, pp. 3104.
Vaisvila, R., Kucera, R.B., Raleigh, E.A., Morgan, R.D., Claus, T.E., Unpublished observations.
Vaisvila, R., Kucera, R.B., Raleigh, E.A., Morgan, R.D., Claus, T.E., European Patent Office, 2001.
Vaisvila, R., Morgan, R.D., Kucera, R.B., Claus, T.E., Raleigh, E.A., Unpublished observations.
Vaisvila, R., Morgan, R.D., Kucera, R.B., Claus, T.E., Raleigh, E.A., US Patent Office, 2005.

<1>MslI
<2>
<3>CAYNN^NNRTG
<4>
<5>Moraxella osloensis
<6>NEB 722
<7>N
<8>Fomenkov, A., Unpublished observations.
Morgan, R.D., Unpublished observations.
Qiang, B.-Q., Wu, S., Kong, H., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>MspI
<2>HpaII
<3>C^CGG
<4>1(5)
<5>Moraxella species ATCC 49670
<6>ATCC 49670
<7>BIJKNQRVX
<8>Anton, B.P., Fomenkov, A., Roberts, R.J., Unpublished observations.
Butkus, V., Petrauskiene, L., Maneliene, Z., Klimasauskas, S., Laucys, V., Janulaitis, A., (1987) Nucleic Acids Res., vol. 15, pp. 7091-7102.
Fomenkov, A., Unpublished observations.
Hornby, D.P.J., Matin, M.M., International Patent Office, 2001.
Jentsch, S., Gunthert, U., Trautner, T.A., (1981) Nucleic Acids Res., vol. 9, pp. 2753-2759.
Matin, M.M., Hornby, D.P., (2000) Anal. Biochem., vol. 278, pp. 46-51.
Puzio, P., Blau, A., Plesch, G., Kamlage, B., Looser, R., Schmitz, O., Wendel, B., European Patent Office, 2009.
Schildkraut, I., Greenough, L., Unpublished observations.
Van Montagu, M., Sciaky, D., Myers, P.A., Roberts, R.J., Unpublished observations.
Walder, R.Y., Langtimm, C.J., Catterjee, R., Walder, J.A., (1983) J. Biol. Chem., vol. 258, pp. 1235-1241.

<1>MspA1I
<2>NspBII
<3>CMG^CKG
<4>?(4)
<5>Moraxella species A1
<6>S.K. Degtyarev
<7>INRV
<8>Degtyarev, S.K., Unpublished observations.
Xu, S.-Y., Unpublished observations.
Xu, S.-Y., Maunus, R., Stropnicky, K., International Patent Office, 2003.

<1>MspJI
<2>
<3>CNNR(9/13)
<4>
<5>Mycobacterium species JLS
<6>C.D. Miller
<7>N
<8>Copeland, A. et al., Unpublished observations.
Zheng, Y., Cohen-Karni, D., Xu, D., Chin, H.G., Wilson, G., Pradhan, S., Roberts, R.J., (2010) Nucleic Acids Res., vol. 38, pp. 5527-5534.
Zheng, Y., Roberts, R.J., International Patent Office, 2010.

<1>MwoI
<2>
<3>GCNNNNN^NNGC
<4>?(4)
<5>Methanobacterium wolfei
<6>DSM 2970
<7>N
<8>Lunnen, K.D., Morgan, R.D., Timan, C.J., Krzycki, J.A., Reeve, J.N., Wilson, G.G., (1989) Gene, vol. 77, pp. 11-19.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Lunnen, K.D., Wilson, G.G., European Patent Office, 1995.
Lunnen, K.D., Wilson, G.G., US Patent Office, 1991.

<1>NaeI
<2>NgoMIV
<3>GCC^GGC
<4>?(5)
<5>Nocardia aerocolonigenes
<6>ATCC 23870
<7>CKN
<8>Guthrie, E.P., Van Cott, E.M., Taron, C.H., European Patent Office, 1997.
Guthrie, E.P., Van Cott, E.M., Taron, C.H., US Patent Office, 1994.
Lunnen, K.D., Barsomian, J.M., Camp, R.R., Card, C.O., Chen, S.-Z., Croft, R., Looney, M.C., Meda, M.M., Moran, L.S., Nwankwo, D.O., Slatko, B.E., Van Cott, E.M., Wilson, G.G., (1988) Gene, vol. 74, pp. 25-32.
Taron, C.H., Van Cott, E.M., Wilson, G.G., Moran, L.S., Slatko, B.E., Hornstra, L.J., Benner, J.S., Kucera, R.B., Guthrie, E.P., (1995) Gene, vol. 155, pp. 19-25.

<1>NarI
<2>KasI,PluTI,SfoI
<3>GG^CGCC
<4>
<5>Nocardia argentinensis
<6>ATCC 31306
<7>JMNQRX
<8>Comb, D.G., Wilson, G., Schildkraut, I., Greenough, L., Unpublished observations.
Zhu, Z., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>NciI
<2>CauII
<3>CC^SGG
<4>2(4)
<5>Neisseria cinerea
<6>NRCC 31006
<7>JNR
<8>Clark, T., Boitano, M., Anton, B.A., Korlach, J., Roberts, R.J., Unpublished observations.
Korch, C., Hagblom, P., (1986) Eur. J. Biochem., vol. 161, pp. 519-524.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Meehan, R.R., Ulrich, E., Bird, A.P., (1993) Nucleic Acids Res., vol. 21, pp. 5517-5518.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Watson, R., Zuker, M., Martin, S.M., Visentin, L.P., (1980) FEBS Lett., vol. 118, pp. 47-50.

<1>NcoI
<2>
<3>C^CATGG
<4>?(4)
<5>Nocardia corallina
<6>ATCC 19070
<7>BCJKMNOQRSXY
<8>Langdale, J.A., Myers, P.A., Roberts, R.J., Unpublished observations.
VanCott, E.M., European Patent Office, 1995.
VanCott, E.M., US Patent Office, 1993.
Zhang, B.-H., Van Cott, E.M., Wilson, G.G., Unpublished observations.

<1>NdeI
<2>
<3>CA^TATG
<4>4(6)
<5>Neisseria denitrificans
<6>NRCC 31009
<7>BJKMNQRSX
<8>Benner, J.S., Unpublished observations.
Clark, T., Boitano, M., Anton, B.A., Korlach, J., Roberts, R.J., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Silber, K.R., Polisson, C., Rees, P.A., Benner, J.S., (1988) Gene, vol. 74, pp. 43-44.
Stickel, S.K., Roberts, R.J., Unpublished observations.
Watson, R.J., Schildkraut, I., Qiang, B.-Q., Martin, S.M., Visentin, L.P., (1982) FEBS Lett., vol. 150, pp. 114-116.

<1>NgoMIV
<2>NaeI
<3>G^CCGGC
<4>2(5)
<5>Neisseria gonorrhoeae MS11
<6>M. So
<7>N
<8>Chien, H.R., (1991) Ph.D. Thesis, University of Maryland, USA, pp. 1-126.
Chien, R.H., Stein, D.C., Seifert, H.S., Floyd, K., So, M., (1988) Abstr. Gen. Meet. Am. Soc. Microbiol., vol. 88, pp. 213.
Gunn, J.S., Piekarowicz, A., Chien, R., Stein, D.C., (1992) J. Bacteriol., vol. 174, pp. 5654-5660.
Ribeiro, F.J., Przybylski, D., Yin, S., Sharpe, T., Gnerre, S., Abouelleil, A., Berlin, A.M., Montmayeur, A., Shea, T.P., Walker, B.J., Young, S.K., Russ, C., Nusbaum, C., Maccallum, I., Jaffe, D.B., (2012) Genome Res., vol. 22, pp. 2270-2277.
Stein, D.C., Chien, R., Seifert, S.H., (1992) J. Bacteriol., vol. 174, pp. 4899-4906.
Stein, D.C., Gunn, J.S., Radlinska, M., Piekarowicz, A., (1995) Gene, vol. 157, pp. 19-22.
Ward, D. et al., Unpublished observations.
Zhu, P., Morelli, G., Achtman, M., (1999) Mol. Microbiol., vol. 33, pp. 635-650.

<1>NheI
<2>BmtI
<3>G^CTAGC
<4>6(4)
<5>Neisseria mucosa
<6>ATCC 25999
<7>BCJKMNOQRSX
<8>Comb, D.G., Grandoni, R., Schildkraut, I., Unpublished observations.
Fomenkov, A., Fei, L., Sun, D., Roberts, R.J., Unpublished observations.
Xu, S.-Y., Xiao, J.-P., European Patent Office, 2001.

<1>NlaIII
<2>CviAII,FatI
<3>CATG^
<4>2(6)
<5>Neisseria lactamica
<6>NRCC 2118
<7>N
<8>Labbe, D., Holtke, H.J., Lau, P.C.K., (1990) Mol. Gen. Genet., vol. 224, pp. 101-110.
Lunnen, K.D., Barsomian, J.M., Camp, R.R., Card, C.O., Chen, S.-Z., Croft, R., Looney, M.C., Meda, M.M., Moran, L.S., Nwankwo, D.O., Slatko, B.E., Van Cott, E.M., Wilson, G.G., (1988) Gene, vol. 74, pp. 25-32.
Morgan, R.D., European Patent Office, 1995.
Qiang, B.-Q., Schildkraut, I., (1986) Nucleic Acids Res., vol. 14, pp. 1991-1999.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>NlaIV
<2>
<3>GGN^NCC
<4>?(5)
<5>Neisseria lactamica
<6>NRCC 2118
<7>N
<8>Lau, P.C.K., Forghani, F., Labbe, D., Bergeron, H., Brousseau, R., Holtke, H.J., (1994) Mol. Gen. Genet., vol. 243, pp. 24-31.
Lunnen, K.D., Barsomian, J.M., Camp, R.R., Card, C.O., Chen, S.-Z., Croft, R., Looney, M.C., Meda, M.M., Moran, L.S., Nwankwo, D.O., Slatko, B.E., Van Cott, E.M., Wilson, G.G., (1988) Gene, vol. 74, pp. 25-32.
Qiang, B.-Q., Schildkraut, I., (1986) Nucleic Acids Res., vol. 14, pp. 1991-1999.

<1>NmeAIII
<2>
<3>GCCGAG(21/19)
<4>5(6)
<5>Neisseria meningitidis Z2491
<6>M. Achtman
<7>N
<8>Morgan, R.D., International Patent Office, 2008.
Morgan, R.D., Dwinell, E.A., Bhatia, T.K., Lang, E.M., Luyten, Y.A., (2009) Nucleic Acids Res., vol. 37, pp. 5208-5221.
Stickel, S.K., Roberts, R.J., Unpublished observations.
Usuda, Y., Nishio, Y., Matsui, K., Sugimoto, S., Koseki, K., US Patent Office, 2008.

<1>NotI
<2>
<3>GC^GGCCGC
<4>2(4)
<5>Nocardia otitidis-caviarum
<6>ATCC 14630
<7>BCJKMNOQRSX
<8>Borsetti, R., Wise, D., Qiang, B.-Q., Schildkraut, I., Unpublished observations.
Fomenkov, A., Unpublished observations.
Morgan, R.D., Benner, J.S., Claus, T.E., US Patent Office, 1994.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Qiang, B.-Q., Schildkraut, I., (1987) Methods Enzymol., vol. 155, pp. 15-21.
Roberts, R.J., Unpublished observations.

<1>NruI
<2>
<3>TCG^CGA
<4>2(4)
<5>Nocardia rubra ATCC 15906
<6>ATCC 15906
<7>BCIJKMNQRSX
<8>Comb, D.G., Schildkraut, I., Greenough, L., Unpublished observations.
Fomenkov, A., Unpublished observations.
Forrow, S., Lee, M., Souhami, R.L., Hartley, J.A., (1994) ACS Abstracts, vol. 208, pp. 97.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Zhu, Z., Unpublished observations.
Zhu, Z., Pedamallu, C.S., Fomenkov, A., Benner, J., Xu, S.-Y., Unpublished observations.

<1>NsiI
<2>AvaIII
<3>ATGCA^T
<4>
<5>Neisseria sicca
<6>ATCC 29256
<7>JMNQRSX
<8>Longo, M.C., Smith, M.D., US Patent Office, 1995.
Schildkraut, I., Jones, G., Parker, P., Grandoni, R., Comb, D.G., Unpublished observations.
Weinstock, G. et al., Unpublished observations.
Xia, Y., Van Etten, J.L., Dobos, P., Ling, Y.Y., Krell, P.J., (1993) Virology, vol. 196, pp. 817-824.
Zhu, Z., Unpublished observations.

<1>NspI
<2>
<3>RCATG^Y
<4>2(5)
<5>Nostoc species C
<6>ATCC 29411
<7>N
<8>Reaston, J., Duyvesteyn, M.G.C., de Waard, A., (1982) Gene, vol. 20, pp. 103-110.
Roberts, R.J., Unpublished observations.
Xu, S.-Y., Xiao, J.-P., Ettwiller, L., Holden, M., Aliotta, J., Poh, C.L., Dalton, M., Robinson, D.P., Petronzio, T.R., Moran, L., Ganatra, M., Ware, J., Slatko, B., Benner, J., (1998) Mol. Gen. Genet., vol. 260, pp. 226-231.

<1>PacI
<2>
<3>TTAAT^TAA
<4>
<5>Pseudomonas alcaligenes
<6>NEB 585
<7>BNO
<8>Anton, B.P., Fomenkov, A., Morgan, R.D., Murray, I.A., Roberts, R.J., Unpublished observations.
Kur, J., (1993) Acta Microbiol. Pol., vol. 42, pp. 145-150.
Morgan, R.D., Unpublished observations.
Morgan, R.D., Luyten, Y.A., Johnson, S.A., Clough, E.M., Clark, T.A., Roberts, R.J., (2016) Nucleic Acids Res., vol. 44, pp. 9413-9425.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Polisson, C., European Patent Office, 1994.
Polisson, C., Fu, P., Unpublished observations.

<1>PaeR7I
<2>XhoI
<3>C^TCGAG
<4>5(6)
<5>Pseudomonas aeruginosa
<6>G.A. Jacoby
<7>N
<8>Ghosh, S.S., Eis, P.S., Blumeyer, K., Fearon, K., Millar, D.P., (1994) Nucleic Acids Res., vol. 22, pp. 3155-3159.
Gingeras, T.R., Brooks, J.E., (1983) Proc. Natl. Acad. Sci. U. S. A., vol. 80, pp. 402-406.
Hinkle, N.F., Miller, R.V., (1979) Plasmid, vol. 2, pp. 387-393.
Theriault, G., Roy, P.H., Howard, K.A., Benner, J.S., Brooks, J.S., Waters, A.F., Gingeras, T.R., (1985) Nucleic Acids Res., vol. 13, pp. 8441-8461.

<1>PciI
<2>BspLU11I
<3>A^CATGT
<4>
<5>Planococcus citreus SE-F45
<6>NEB 1781
<7>IN
<8>Abdurashitov, M.A., Nayakshina, T.N., Lebedeva, N.A., Dedkov, V.S., Degtyarev, S.K., Unpublished observations.
Dedkov, V.S., Gonchar, D.A., Abdurashitov, M.A., Udalyeva, S.G., Urumceva, L.A., Chernukhin, V.A., Mutylo, G.V., Degtyarev, S.K., (2015) Res. J. Pharm. Biol. Chem. Sci., vol. 6, pp. 1341-1348.
Zhu, Z., Blanchard, A., Xu, S.-Y., Guan, S., Wei, H., Zhang, P., Sun, D., Chan, S.-h., International Patent Office, 2009.
Zhu, Z., Roberts, R.J., Unpublished observations.
Zhu, Z., Xu, S.-Y., Unpublished observations.

<1>PflFI
<2>Tth111I
<3>GACN^NNGTC
<4>
<5>Pseudomonas fluorescens biotype F
<6>NEB 999
<7>N
<8>Nkenfou, C., Polisson, C., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>PflMI
<2>
<3>CCANNNN^NTGG
<4>
<5>Pseudomonas fluorescens
<6>NEB 375
<7>N
<8>Morgan, R.D., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Nwankwo, D., Unpublished observations.
Nwankwo, D.O., Moran, L.S., Perler, F.B., Slatko, B.E., Wilson, G.G., Benner, J.S., Unpublished observations.

<1>PleI
<2>MlyI
<3>GAGTC(4/5)
<4>2(6)
<5>Pseudomonas lemoignei
<6>NEB 418
<7>N
<8>Fomenkov, A., Unpublished observations.
Fomenkov, A., Unpublished observations.
Kong, H., Higgins, L., Dalton, M., Kucera, R., Schildkraut, I., Wilson, G., European Patent Office, 2007.
Kong, H., Higgins, L.S., US Patent Office, 2002.
Morgan, R., Stote, R., Soltis, A., Unpublished observations.

<1>PluTI
<2>NarI,KasI,SfoI
<3>GGCGC^C
<4>?(5)
<5>Photorhabdus luminescens
<6>E. Duchaud
<7>N
<8>Duchaud, E. et al., (2003) Nat. Biotechnol., vol. 21, pp. 1307-1313.
Khan, F., Furuta, Y., Kawai, M., Kaminska, K.H., Ishikawa, K., Bujnicki, J.M., Kobayashi, I., (2010) Nucleic Acids Res., vol. 38, pp. 3019-3030.

<1>PmeI
<2>
<3>GTTT^AAAC
<4>
<5>Pseudomonas mendocina
<6>NEB 698
<7>N
<8>Chang, Z., Morgan, R.D., US Patent Office, 1999.
Morgan, R., Zhou, B., US Patent Office, 1993.
Morgan, R.D., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.

<1>PmlI
<2>PmaCI
<3>CAC^GTG
<4>3(5)
<5>Pseudomonas maltophilia
<6>NEB 515
<7>N
<8>Anton, B.P., Fomenkov, A., Roberts, R.J., Unpublished observations.
Fomenkov, A., Unpublished observations.
Tenkanen, T., Unpublished observations.
Zhu, Z., Vaisvila, R., Unpublished observations.

<1>PpuMI
<2>
<3>RG^GWCCY
<4>?(5)
<5>Pseudomonas putida M
<6>NEB 372
<7>N
<8>Morgan, R., Hempstead, S.K., Unpublished observations.
Samuelson, J., Xu, S.-Y., Unpublished observations.

<1>PshAI
<2>
<3>GACNN^NNGTC
<4>2(6)
<5>Plesiomonas shigelloides 319-73
<6>T. Shimada
<7>KN
<8>Chang, Z., Morgan, R.D., European Patent Office, 1997.
Miyahara, M., Nakajima, K., Shimada, T., Mise, K., (1990) Gene, vol. 87, pp. 119-122.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>PsiI
<2>
<3>TTA^TAA
<4>
<5>Pseudomonas species SE-G49
<6>NEB 1784
<7>IN
<8>Abdurashitov, M.A., Belichenko, O.A., Lebedeva, N.A., Degtyarev, S.K., (1999) Biokhimiia, vol. 64, pp. 574-576.
Zhu, Z., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>PI-PspI
<2>
<3>TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
<4>
<5>Pyrococcus species
<6>NEB 613
<7>N
<8>Abdurashitov, M.A., Belichenko, O.A., Shevchenko, A.V., Degtyarev, S.K., (1995) Nucleic Acids Res., vol. 23, pp. 2571-2572.
Davis, T.B., Unpublished observations.
Xu, M.-Q., Southworth, M.W., Mersha, F.B., Hornstra, L.J., Perler, F.B., (1993) Cell, vol. 75, pp. 1371-1377.

<1>PspGI
<2>EcoRII,BstNI
<3>^CCWGG
<4>?(4)
<5>Pyrococcus species G1H
<6>NEB 906
<7>N
<8>Morgan, R., Xiao, J.-P., Xu, S.-Y., (1998) Appl. Environ. Microbiol., vol. 64, pp. 3669-3673.

<1>PspOMI
<2>ApaI
<3>G^GGCCC
<4>
<5>Pseudomonas species OM2164
<6>NEB 1783
<7>INV
<8>Belichenko, O.A., Shevchenko, A.V., Abdurashitov, M.A., Degtyarev, S.K., Unpublished observations.
Fomenkov, A., Unpublished observations.

<1>PspXI
<2>
<3>VC^TCGAGB
<4>
<5>Pseudomonas species A1-1
<6>NEB 1782
<7>IN
<8>Gonchar, D.A., Abdurashitov, M.A., Belichenko, O.A., Dedkov, V.S., Mezentseva, N.V., Tomilova, J.E., Degtyarev, S.K., (2005) Ovchinnikov Bull. Biotechnol. Phys. Chem. Biol., vol. 1, pp. 18-23.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>PstI
<2>
<3>CTGCA^G
<4>5(6)
<5>Providencia stuartii 164
<6>ATCC 49762
<7>BCIJKMNOQRSVX
<8>Brown, N.L., Smith, M., (1976) FEBS Lett., vol. 65, pp. 284-287.
Handique, A.K., (1994) Curr. Sci., vol. 66, pp. 103-104.
Morgan, R.D., Unpublished observations.
Sagawa, H., Ohshima, A., Kato, I., (1995) Nucleic Acids Res., vol. 23, pp. 2367-2370.
Smith, D.I., Blattner, F.R., Davies, J., (1976) Nucleic Acids Res., vol. 3, pp. 343-353.
Treml, S., Draveling, C., Huang, C., Heaster, J., Walker, D., DiFrancesco, R., Jolly, J., (1994) Clin. Chem., vol. 40, pp. 1092.
Walder, R.Y., (1984) Ph.D. Thesis (The University of Iowa, Department of Biology, none), pp. 1-228.
Walder, R.Y., Walder, J.A., Donelson, J.E., (1984) J. Biol. Chem., vol. 259, pp. 8015-8026.
Xia, Y., Van Etten, J.L., Dobos, P., Ling, Y.Y., Krell, P.J., (1993) Virology, vol. 196, pp. 817-824.

<1>PvuI
<2>
<3>CGAT^CG
<4>
<5>Proteus vulgaris
<6>ATCC 13315
<7>BKMNOQRSX
<8>Fomenkov, A., Unpublished observations.
Gingeras, T.R., Greenough, L., Schildkraut, I., Roberts, R.J., (1981) Nucleic Acids Res., vol. 9, pp. 4525-4536.
Katsuragi, N.T., Kawakami, B., Maekawa, Y., European Patent Office, 1994.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Smith, M.D., Longo, M., Gerard, G.F., Chatterjee, D.K., (1992) Nucleic Acids Res., vol. 20, pp. 5743-5747.

<1>PvuII
<2>
<3>CAG^CTG
<4>4(4)
<5>Proteus vulgaris
<6>ATCC 13315
<7>BCIJKMNOQRSVX
<8>Butkus, V., Klimasauskas, S., Petrauskiene, L., Maneliene, Z., Lebionka, A., Janulaitis, A., (1987) Biochim. Biophys. Acta, vol. 909, pp. 201-207.
Fomenkov, A., Unpublished observations.
Gingeras, T.R., Greenough, L., Schildkraut, I., Roberts, R.J., (1981) Nucleic Acids Res., vol. 9, pp. 4525-4536.
Kuehne, C., Simoncsits, A., International Patent Office, 2004.
Kyune, C., Shimonchitoshu, A., Japanese Patent Office, 2006.
Rice, M.R., Calvin-Koons, M.D., Blumenthal, R.M., (1995) FASEB J., vol. 9.
Tao, T., Walter, J., Brennan, K.J., Cotterman, M.M., Blumenthal, R.M., (1989) Nucleic Acids Res., vol. 17, pp. 4161-4175.

<1>RsaI
<2>CviQI
<3>GT^AC
<4>4(4)
<5>Rhodopseudomonas sphaeroides
<6>S. Kaplan
<7>BCIJMNQRSVXY
<8>Dedkov, V.S., Gonchar, D.A., Abdurashitov, M.A., Udalyeva, S.G., Urumceva, L.A., Chernukhin, V.A., Mutylo, G.V., Degtyarev, S.K., (2015) Res. J. Pharm. Biol. Chem. Sci., vol. 6, pp. 1341-1348.
Fomenkov, A., Unpublished observations.
Lunnen, K.D., Meixsell, T., Morgan, R.D., Wilson, G.G., European Patent Office, 2001.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Lynn, S.P., Cohen, L.K., Kaplan, S., Gardner, J.F., (1980) J. Bacteriol., vol. 142, pp. 380-383.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>RsrII
<2>
<3>CG^GWCCG
<4>?(5)
<5>Rhodobacter sphaeroides strain 630
<6>S. Kaplan
<7>NQX
<8>Morgan, R.D., Unpublished observations.
O'Connor, C.D., Metcalf, E., Wrighton, C.J., Harris, T.J.R., Saunders, J.R., (1984) Nucleic Acids Res., vol. 12, pp. 6701-6708.

<1>SacI
<2>Eco53kI
<3>GAGCT^C
<4>4(5)
<5>Streptomyces achromogenes
<6>ATCC 12767
<7>BJKMNOQRSX
<8>Arrand, J.R., Myers, P.A., Roberts, R.J., Unpublished observations.
Xu, S.-Y., Xiao, J.-P., Ettwiller, L., Holden, M., Aliotta, J., Poh, C.L., Dalton, M., Robinson, D.P., Petronzio, T.R., Moran, L., Ganatra, M., Ware, J., Slatko, B., Benner, J., (1998) Mol. Gen. Genet., vol. 260, pp. 226-231.

<1>SacII
<2>
<3>CCGC^GG
<4>2(5)
<5>Streptomyces achromogenes
<6>ATCC 12767
<7>BJKNOQRX
<8>Arrand, J.R., Myers, P.A., Roberts, R.J., Unpublished observations.
Benner, J., Lunnen, K., Unpublished observations.
Guthrie, E., Meda, M., European Patent Office, 1995.
Lunnen, K.D., Barsomian, J.M., Camp, R.R., Card, C.O., Chen, S.-Z., Croft, R., Looney, M.C., Meda, M.M., Moran, L.S., Nwankwo, D.O., Slatko, B.E., Van Cott, E.M., Wilson, G.G., (1988) Gene, vol. 74, pp. 25-32.
Lunnen, K.D., Meda, M.M., Guthrie, E.P., Wilson, G.G., Benner, J.S., Unpublished observations.
Meda, M.M., Wilson, G.G., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Samuelson, J., Unpublished observations.

<1>SalI
<2>
<3>G^TCGAC
<4>5(6)
<5>Streptomyces albus G
<6>ATCC 49789
<7>BCIJKMNOQRSVX
<8>Alvarez, M.A., Chater, K.F., Rosario, M.R., (1993) Mol. Microbiol., vol. 8, pp. 243-252.
Arrand, J.R., Myers, P.A., Roberts, R.J., (1978) J. Mol. Biol., vol. 118, pp. 127-135.
Rodicio, M.R., Quinton-Jager, T., Moran, L.S., Slatko, B.E., Wilson, G.G., (1994) Gene, vol. 151, pp. 167-172.

<1>SapI
<2>BspQI
<3>GCTCTTC(1/4)
<4>2(4),-5(6)
<5>Saccharopolyspora species
<6>NEB 597
<7>N
<8>Beck, R., Burtscher, H., (1994) Nucleic Acids Res., vol. 22, pp. 886-887.
Morgan, R.D., Unpublished observations.
Samuelson, J., Unpublished observations.
Xu, S.-Y., Xiao, J.-P., Ettwiller, L., Holden, M., Aliotta, J., Poh, C.L., Dalton, M., Robinson, D.P., Petronzio, T.R., Moran, L., Ganatra, M., Ware, J., Slatko, B., Benner, J., (1998) Mol. Gen. Genet., vol. 260, pp. 226-231.
Xu, S.-Y., Xiao, J.-P., Poh, C.L., Maunus, R.E., Unpublished observations.

<1>Sau96I
<2>AsuI
<3>G^GNCC
<4>4(5)
<5>Staphylococcus aureus PS96
<6>ATCC 49831
<7>JN
<8>Puzio, P., Blau, A., Plesch, G., Kamlage, B., Looser, R., Schmitz, O., Wendel, B., European Patent Office, 2009.
Sussenbach, J.S., Steenbergh, P.H., Rost, J.A., van Leeuwen, W.J., van Embden, J.D.A., (1978) Nucleic Acids Res., vol. 5, pp. 1153-1163.
Szilak, L., Venetianer, P., Kiss, A., (1990) Nucleic Acids Res., vol. 18, pp. 4659-4664.

<1>Sau3AI
<2>MboI,DpnII
<3>^GATC
<4>4(5)
<5>Staphylococcus aureus 3A
<6>ATCC 49834
<7>CJKMNRX
<8>Klimasauskas, S., Lebionka, A., Butkus, V., Janulaitis, A., Unpublished observations.
Lebenka, A.Y., Rackus, Y.A., (1989) Biokhimiia, vol. 54, pp. 1009-1014.
Mohn, W.W., Teather, R.M., (1995) Gene, vol. 155, pp. 131-132.
Sussenbach, J.S., Monfoort, C.H., Schiphof, R., Stobberingh, E.E., (1976) Nucleic Acids Res., vol. 3, pp. 3193-3202.

<1>SbfI
<2>Sse8387I
<3>CCTGCA^GG
<4>
<5>Streptomyces species Bf-61
<6>S.K. Degtyarev
<7>INV
<8>Lunnen, K., Davis, T., Wilson, G., European Patent Office, 2005.
Lunnen, K.D., Davis, T., Wilson, G.G., US Patent Office, 2005.
Lunnen, K.D., Wilson, G.G., Unpublished observations.

<1>ScaI
<2>
<3>AGT^ACT
<4>5(4)
<5>Streptomyces caespitosus
<6>H. Takahashi
<7>BCJKMNOQRSX
<8>Grandoni, R.P., Schildkraut, I., Unpublished observations.
Stickel, S.K., Roberts, R.J., Unpublished observations.
Takahashi, H., Kojima, H., Saito, H., (1985) Biochem. J., vol. 231, pp. 229-232.
Xu, S.-Y., Xiao, J.-P., Unpublished observations.
Xu, S.-Y., Xiao, J.-P., Unpublished observations.

<1>I-SceI
<2>
<3>TAGGGATAACAGGGTAAT(-9/-13)
<4>
<5>Saccharomyces cerevisiae
<6>B. Dujon
<7>BMN
<8>Choulika, A., Perrin, A., Dujon, B., Nicolas, J., Japanese Patent Office, 2006.
Choulika, A., Perrin, A., Dujon, B., Nicolas, J., Japanese Patent Office, 2007.
Choulika, A., Perrin, A., Dujon, B., Nicolas, J.-F., International Patent Office, 1996.
Colleaux, L., D'Auriol, L., Galibert, F., Dujon, B., (1988) Proc. Natl. Acad. Sci. U. S. A., vol. 85, pp. 6022-6026.
D'Halluin, K., Ruiter, R., International Patent Office, 2006.
Dujon, B., (1980) Cell, vol. 20, pp. 185-197.
Foury, F., Roganti, T., Lecrenier, N., Purnelle, B., (1998) FEBS Lett., vol. 440, pp. 325-331.
Kim, S., Lee, C., Lim, B., Sung, B., Yu, B., Lee, W., Lee, J., Lee, S., Korean Patent Office, 2004.
Kim, S., Lee, W., Yu, B., Sung, B., Kim, J., Lee, C., Lee, J., Korean Patent Office, 2002.
Sanchez-Fernandez, R., Biesgen, C., Leps, M., Brown, J.A., International Patent Office, 2006.
Siegl, T., Petzke, L., Welle, E., Luzhetskyy, A., (2010) Appl. Microbiol. Biotechnol., vol. 87, pp. 1525-1532.
Song, H.S., Lai, F.M., Roche, C.E., Brown, J.A., International Patent Office, 2008.
Vanderstraeten, C., D'Halluin, K., Ruite, R., Japanese Patent Office, 2007.

<1>PI-SceI
<2>
<3>ATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGG(-22/-26)
<4>
<5>Saccharomyces cerevisiae
<6>J. Thorner
<7>N
<8>Bremer, M.C.D., Gimble, F.S., Thorner, J., Smith, C.L., (1992) Nucleic Acids Res., vol. 20, pp. 5484.
Gimble, F.S., Thorner, J., (1992) Nature, vol. 357, pp. 301-306.
Gimble, F.S., Thorner, J., (1993) J. Biol. Chem., vol. 268, pp. 21844-21853.
Grivell, L.A., (1992) Curr. Biol., vol. 2, pp. 450-452.
Hirata, R., Ohsumi, Y., Nakano, A., Kawasaki, H., Suzuki, K., Anraku, Y., (1990) J. Biol. Chem., vol. 265, pp. 6726-6733.
Kane, P.M., Yamashiro, C.T., Wolczyk, D.F., Neff, N., Goebl, M., Stevens, T.H., (1990) Science, vol. 250, pp. 651-657.
Shub, D.A., Goodrich-Blair, H., (1992) Cell, vol. 71, pp. 183-186.

<1>ScrFI
<2>StyD4I
<3>CC^NGG
<4>2(5)
<5>Streptococcus cremoris F
<6>C. Daly
<7>JN
<8>Anton, B.P., Fomenkov, A., Roberts, R.J., Unpublished observations.
Davis, R., Van der Lelie, D., Mercenier, A., Daly, C., Fitzgerald, G.F., (1993) Appl. Environ. Microbiol., vol. 59, pp. 777-785.
Fitzgerlad, G.F., Daly, C., Brown, L.R., Gingeras, T.R., (1982) Nucleic Acids Res., vol. 10, pp. 8171-8179.
Fomenkov, A., Unpublished observations.
Hill, C., (1993) FEMS Microbiol. Rev., vol. 12, pp. 87-108.
Twomey, D.P., Davis, R., Daly, C., Fitzgerald, G.F., (1993) Irish J. Agr. Food Res., vol. 32, pp. 217.

<1>SexAI
<2>
<3>A^CCWGGT
<4>2(5)
<5>Streptomyces exfoliatus
<6>B. Frey
<7>MN
<8>Fomenkov, A., Anton, B.P., Unpublished observations.
Frey, B., Unpublished observations.
Kaluza, K., Auer, J., Frey, B., European Patent Office, 1992.
Wu, V., Anton, B.P., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>SfaNI
<2>
<3>GCATC(5/9)
<4>
<5>Streptococcus faecalis ND547
<6>ATCC 49761
<7>INV
<8>Furmanek-Blaszk, B., Sektas, M., (2015) FEMS Microbiol. Lett., vol. 362.
Samuelson, J., Unpublished observations.
Samuelson, J., Wilson, G.G., Xu, S.-Y., Unpublished observations.
Schildkraut, I., Greenough, L., Unpublished observations.
Sciaky, D., Roberts, R.J., Unpublished observations.
Tomilova, Y.E., Abdurashitov, M.A., Golikova, L.N., Netesova, N.A., Degtyarev, S.K., (2004) Mol. Biol. (Mosk), vol. 38, pp. 850-856.

<1>SfcI
<2>SfeI
<3>C^TRYAG
<4>
<5>Streptococcus faecium
<6>NEB 674
<7>N
<8>Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Polisson, C., Meloni, A., Unpublished observations.
Zhu, Z., Unpublished observations.
Zhu, Z., Xu, S.-Y., Unpublished observations.

<1>SfiI
<2>
<3>GGCCNNNN^NGGCC
<4>?(4)
<5>Streptomyces fimbriatus
<6>ATCC 15051
<7>BCIJKMNOQRSVX
<8>Qiang, B.-Q., Schildkraut, I., (1984) Nucleic Acids Res., vol. 12, pp. 4507-4515.
Sasaki, A., Oka, M., Shigenori, M., Japanese Patent Office, 1992.
Van Cott, E.M., Moran, L.S., Slatko, B.E., Wilson, G.G., Unpublished observations.
Vancott, E.M., European Patent Office, 1995.
Wentzell, L.M., Oram, M., Halford, S.E., (1994) Biochem. Soc. Trans., vol. 22, pp. 302S.

<1>SfoI
<2>NarI,KasI,PluTI
<3>GGC^GCC
<4>?(5)
<5>Serratia fonticola
<6>NEB 369
<7>N
<8>Krotee, S., Ganatra, M., Grandoni, R., Unpublished observations.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Morgan, R.D., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.

<1>SgrAI
<2>
<3>CR^CCGGYG
<4>?(5)
<5>Streptomyces griseus
<6>U. Mayr
<7>N
<8>Kong, H., Higgins, L.S., Dalton, M.A., US Patent Office, 2000.
Tautz, N., Kaluza, K., Frey, B., Jarsch, M., Schmitz, G.G., Kessler, C., (1990) Nucleic Acids Res., vol. 18, pp. 3087.

<1>SmaI
<2>TspMI,XmaI
<3>CCC^GGG
<4>2(4)
<5>Serratia marcescens Sb
<6>ATCC 49779
<7>BCIJKMNOQRSVXY
<8>Butkus, V., Petrauskiene, L., Maneliene, Z., Klimasauskas, S., Laucys, V., Janulaitis, A., (1987) Nucleic Acids Res., vol. 15, pp. 7091-7102.
Endow, S.A., Roberts, R.J., (1977) J. Mol. Biol., vol. 112, pp. 521-529.
Greene, R., Mulder, C., Unpublished observations.
Klimasauskas, S., Steponaviciene, D., Maneliene, Z., Petrusyte, M., Butkus, V., Janulaitis, A., (1990) Nucleic Acids Res., vol. 18, pp. 6607-6609.

<1>SmlI
<2>
<3>C^TYRAG
<4>5(6)
<5>Stenotrophomonas maltophilia
<6>NEB 1007
<7>N
<8>Fomenkov, A., Unpublished observations.
Le, T.K.T., Vu, H.N., Vu, T.K.L., Polisson, C., Morgan, R., Unpublished observations.
Wei, H., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>SnaBI
<2>
<3>TAC^GTA
<4>3(4)
<5>Sphaerotilus natans
<6>ATCC 15291
<7>CKMNR
<8>Borsetti, R., Grandoni, R., Schildkraut, I., Unpublished observations.
Lunnen, K.D., Wilson, G.G., Unpublished observations.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>SpeI
<2>
<3>A^CTAGT
<4>
<5>Sphaerotilus natans
<6>ATCC 13923
<7>BJKMNOQRSX
<8>Chang, Z., Morgan, R., Unpublished observations.
Comb, D.G., Grandoni, R., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Stewart, F., Morgan, R.D., Unpublished observations.

<1>SphI
<2>
<3>GCATG^C
<4>
<5>Streptomyces phaeochromogenes
<6>NRRL B-3559
<7>BCIJKMNOQRSVX
<8>Bhattacharya, S.K., Dubey, A.K., (1994) Biotechnol. Appl. Biochem., vol. 20, pp. 141-146.
Dedkov, V.S., Gonchar, D.A., Abdurashitov, M.A., Udalyeva, S.G., Urumceva, L.A., Chernukhin, V.A., Mutylo, G.V., Degtyarev, S.K., (2015) Res. J. Pharm. Biol. Chem. Sci., vol. 6, pp. 1341-1348.
Fuchs, L.Y., Covarrubias, L., Escalante, L., Sanchez, S., Bolivar, F., (1980) Gene, vol. 10, pp. 39-46.
Lunnen, K.D., Barsomian, J.M., Camp, R.R., Card, C.O., Chen, S.-Z., Croft, R., Looney, M.C., Meda, M.M., Moran, L.S., Nwankwo, D.O., Slatko, B.E., Van Cott, E.M., Wilson, G.G., (1988) Gene, vol. 74, pp. 25-32.
Roberts, R.J., Unpublished observations.

<1>SrfI
<2>
<3>GCCC^GGGC
<4>
<5>Streptomyces species Srf
<6>T.G. Simcox
<7>N
<8>Fomenkov, A., Unpublished observations.
Simcox, T.G., Marsh, S.J., Gross, E.A., Lernhardt, W., Davis, S., Simcox, M.E.C., (1991) Gene, vol. 109, pp. 121-123.
Weiner, M., Costa, G., (1994) Abstr. Gen. Meet. Am. Soc. Microbiol., vol. 94, pp. 249.

<1>SspI
<2>
<3>AAT^ATT
<4>?(6)
<5>Sphaerotilus species
<6>ATCC 13925
<7>BCIJKNQRVX
<8>Benner, J.S., Coe, L., Unpublished observations.
Benner, J.S., Coe, L.H., Unpublished observations.
Schildkraut, I., Grandoni, R., Unpublished observations.

<1>M.SssI
<2>
<3>CG
<4>1(5)
<5>Spiroplasma species MQ1
<6>A. Razin
<7>
<8>Jack, W., Unpublished observations.
Razin, A., Rottem, S., Renbaum, P.F., European Patent Office, 1995.
Razin, A., Rottem, S., Renbaum, P.F., US Patent Office, 1994.
Renbaum, P., Abrahamove, D., Fainsod, A., Wilson, G.G., Rottem, S., Razin, A., (1990) Nucleic Acids Res., vol. 18, pp. 1145-1152.

<1>StuI
<2>
<3>AGG^CCT
<4>
<5>Streptomyces tubercidicus
<6>H. Takahashi
<7>BJKMNQRSX
<8>Casjens, S., Hayden, M., Jackson, E., Deans, R., (1983) J. Virol., vol. 45, pp. 864-867.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Shimotsu, H., Takahashi, H., Saito, H., (1980) Gene, vol. 11, pp. 219-225.
Xu, S., Zhu, Z., Japanese Patent Office, 2009.
Zhu, Z., Unpublished observations.
Zhu, Z., Samuelson, J., Xiao, J.-P., Xu, S.-Y., Unpublished observations.
Zhu, Z., Xu, S.-Y., Unpublished observations.

<1>StyI
<2>
<3>C^CWWGG
<4>?(4)
<5>Salmonella typhi 27
<6>E.S. Anderson
<7>CJN
<8>Benner, J.S., Unpublished observations.
Mise, K., Nakajima, K., (1985) Gene, vol. 33, pp. 357-361.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.

<1>StyD4I
<2>ScrFI
<3>^CCNGG
<4>?(5)
<5>Salmonella typhi D4
<6>E.S. Anderson
<7>N
<8>Miyahara, M., Ishiwata, N., Yoshida, Y., (1997) Biol. Pharm. Bull., vol. 20, pp. 201-203.
Miyahara, M., Mise, K., (1993) Gene, vol. 129, pp. 83-86.

<1>SwaI
<2>
<3>ATTT^AAAT
<4>?(6)
<5>Staphylococcus warneri
<6>B. Frey
<7>JMNS
<8>Higgins, L.S., Kong, H., Unpublished observations.
Lechner, M., Frey, B., Laue, F., Ankenbauer, W., Schmitz, G., (1992) Fresenius Z. Anal. Chem., vol. 343, pp. 121-122.

<1>TaqI
<2>
<3>T^CGA
<4>4(6)
<5>Thermus aquaticus YTI
<6>J.I. Harris
<7>BCIJKMNQRSVX
<8>Anton, B.P., Unpublished observations.
Anton, B.P., Brooks, J.E., Unpublished observations.
Fomenkov, A., Xiao, J.-P., Dila, D., Raleigh, E., Xu, S.-Y., (1994) Nucleic Acids Res., vol. 22, pp. 2399-2403.
McClelland, M., (1981) Nucleic Acids Res., vol. 9, pp. 6795-6804.
Sato, S., Hutchison, C.A. III, Harris, J.I., (1977) Proc. Natl. Acad. Sci. U. S. A., vol. 74, pp. 542-546.
Zebala, J.A., (1993) Diss. Abstr., vol. 54, pp. 1394-B.
Zylicz-Stachula, A., Jezewska-Frackowiak, J., Czajkowska, E., Skowron, P.M., Unpublished observations.

<1>TfiI
<2>
<3>G^AWTC
<4>2(6)
<5>Thermus filiformis
<6>NEB 570
<7>N
<8>Cowan, D., Ward, J., Pelletier, J.J., Morgan, R., Unpublished observations.
Hiesh, P.-C., Allen, R., Xu, S.-Y., Unpublished observations.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>TseI
<2>ApeKI
<3>G^CWGC
<4>2(4)
<5>Thermus species 93170
<6>D. Clark
<7>N
<8>Fomenkov, A., Unpublished observations.
Morgan, R.D., Unpublished observations.
Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Tassoni, L., Clark, D.R., Unpublished observations.
Xu, S.-Y., Unpublished observations.

<1>Tsp45I
<2>
<3>^GTSAC
<4>4(6)
<5>Thermus species strain YS45
<6>R.J. Sharp
<7>N
<8>Raven, N.D.H., Williams, R.A.D., Smith, K.E., Kelly, C.D., Carter, N.D., (1993) Nucleic Acids Res., vol. 21, pp. 4397.
Stickel, S.K., Roberts, R.J., Unpublished observations.
Wayne, J., Holden, M., Xu, S.-Y., (1997) Gene, vol. 202, pp. 83-88.

<1>TspMI
<2>SmaI,XmaI
<3>C^CCGGG
<4>?(5)
<5>Thermophilic strain M
<6>P. Sharma
<7>N
<8>Morgan, R.D., Unpublished observations.
Parashar, V., Capalash, N., Xu, S.Y., Sako, Y., Sharma, P., (2006) Appl. Microbiol. Biotechnol., vol. 72, pp. 917-923.
Sharma, P., Parashar, V., Capalash, N., Unpublished observations.
Zheng, Y., Unpublished observations.
Zheng, Y., Roberts, R.J., (2007) Nucleic Acids Res., vol. 35.
Zheng, Y., Roberts, R.J., International Patent Office, 2008.

<1>TspRI
<2>
<3>CASTGNN^
<4>1(5)
<5>Thermus species strain R
<6>N.D.H. Raven
<7>N
<8>Benner, J., Dalton, M.A., Xu, S., Dore, A., Japanese Patent Office, 2005.
Raven, N.D.H., Kelly, C.D., Carter, N.D., Smith, K.E., Williams, R.A.D., Unpublished observations.
Xu, S.-Y., Unpublished observations.
Xu, S.-Y., Dore, A., Dalton, M., Benner, J., US Patent Office, 2003.

<1>Tth111I
<2>PflFI
<3>GACN^NNGTC
<4>2(6)
<5>Thermus thermophilus strain 111
<6>T. Oshima
<7>IKNQVX
<8>Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Shinomiya, T., Sato, S., (1980) Nucleic Acids Res., vol. 8, pp. 43-56.
Stickel, S.K., Roberts, R.J., Unpublished observations.
Xu, S.-Y., Unpublished observations.

<1>XbaI
<2>
<3>T^CTAGA
<4>6(6)
<5>Xanthomonas badrii
<6>ATCC 11672
<7>BCIJKMNQRSVX
<8>Fomenkov, A., Unpublished observations.
Patel, Y., Van Cott, E., Wilson, G.G., McClelland, M., (1990) Nucleic Acids Res., vol. 18, pp. 1603-1607.
Zain, B.S., Roberts, R.J., (1977) J. Mol. Biol., vol. 115, pp. 249-255.

<1>XcmI
<2>
<3>CCANNNNN^NNNNTGG
<4>3(6)
<5>Xanthomonas campestris
<6>NEB 497
<7>N
<8>Morgan, R.D., Roberts, R.J., International Patent Office, 2007.
Nwankwo, D., Unpublished observations.
Nwankwo, D.O., Slatko, B.E., Unpublished observations.
Polisson, C., Morgan, R., Unpublished observations.
Shaw, P.C., Mok, Y.K., (1993) Gene, vol. 133, pp. 85-89.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>XhoI
<2>PaeR7I
<3>C^TCGAG
<4>5(6)
<5>Xanthomonas holcicola
<6>ATCC 13461
<7>BJKMNOQRSX
<8>Anton, B.P., Benner, J.S., Moran, L.S., Morita, M., Sugino, Y., Brooks, J.E., Unpublished observations.
Fomenkov, A., Unpublished observations.
Gingeras, T.R., Myers, P.A., Olson, J.A., Hanberg, F.A., Roberts, R.J., (1978) J. Mol. Biol., vol. 118, pp. 113-122.
Morita, M., Sugino, Y., Unpublished observations.
Stickel, S.K., Roberts, R.J., Unpublished observations.

<1>XmaI
<2>SmaI,TspMI
<3>C^CCGGG
<4>2(4)
<5>Xanthomonas malvacearum
<6>ATCC 9924
<7>INRV
<8>Endow, S.A., Roberts, R.J., (1977) J. Mol. Biol., vol. 112, pp. 521-529.
Fomenkov, A., Unpublished observations.
Lunnen, K.D., Wilson, G.G., European Patent Office, 1998.
Lunnen, K.D., Wilson, G.G., US Patent Office, 1991.

<1>XmnI
<2>
<3>GAANN^NNTTC
<4>2(6)
<5>Xanthomonas manihotis 7AS1
<6>ATCC 49764
<7>NR
<8>Fomenkov, A., Unpublished observations.
Fomenkov, A., Roberts, R.J., Unpublished observations.
Lin, B.-C., Chien, M.-C., Lou, S.-Y., (1980) Nucleic Acids Res., vol. 8, pp. 6189-6198.
Nwankwo, D.O., Lynch, J.J., Moran, L.S., Fomenkov, A., Slatko, B.E., (1996) Gene, vol. 173, pp. 121-127.
Qiang, B.-Q., Schildkraut, I., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

<1>ZraI
<2>AatII
<3>GAC^GTC
<4>
<5>Zoogloea ramigera 11
<6>NEB 1785
<7>INV
<8>Dedkov, V.S., Sinichkina, S.A., Popichenko, D.V., Degtyarev, S.K., (2001) Biotekhnologiya, vol. 6, pp. 3-7.
Wei, H., Zhu, Z., Unpublished observations.
Zhu, Z., Roberts, R.J., Unpublished observations.

